Informācija

Vai inficēto personu asinīs ir nosakāms baktēriju DNS daudzums?

Vai inficēto personu asinīs ir nosakāms baktēriju DNS daudzums?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ar kādu baktēriju infekciju cilvēkiem ir pierādīts, ka asinīs var atrast baktēriju DNS?

Ja kāds tiek atrasts, tas, visticamāk, nav ļoti daudz un pat grūti atšķirt no cilvēka DNS, taču, domājams, nesenajiem sekvences sasniegumiem vajadzēja to darīt iespējamu.


Viss ir atkarīgs no infekcijas un pacienta vispārējā imunitātes stāvokļa.

Parasti priekšnoteikums, lai DNS brīvi cirkulētu asinīs, ir pašu baktēriju klātbūtne asinīs (bakterēmija). Tas nozīmē, ka infekcija atstāja savu sākotnējo vietu (kur imūnsistēma to parasti izolē no asins plūsmas). Atkarībā no ķermeņa reakcijas uz šo izrāvienu, sekas var būt sepse un/vai SIRS.

Šādos apstākļos (ne vienmēr tik smagi kā sepse, bet pierādītas bakteriēmijas gadījumā) imūnšūnas uzbrūk baktēriju šūnām, kas noved pie to lizēšanas un satura izdalīšanas asinīs.

PCR var izmantot kā metodi, lai pierādītu baktēriju DNS esamību. (Šeit ir publiski pieejams raksts par šo tēmu).


Vai inficēto personu asinīs ir nosakāms baktēriju DNS daudzums? - Bioloģija

1. attēls. Frīdrihs Mišers (1844–1895) atklāja nukleīnskābes.

Mūsu pašreizējā izpratne par DNS sākās ar nukleīnskābju atklāšanu, kam sekoja dubultās spirāles modeļa izstrāde. 19. gadsimta 60. gados Frīdrihs Mišers (1. attēls), pēc profesijas ārsts, izdalīja fosfātiem bagātas ķīmiskas vielas no baltajām asins šūnām (leikocītiem). Viņš nosauca šīs ķīmiskās vielas (kas galu galā būtu pazīstamas kā DNS) nukleīns jo tie bija izolēti no šūnu kodoliem.

Lai redzētu, ka Mīsers veic eksperimentu soli pa solim, noklikšķiniet uz šī pārskata par to, kā viņš atklāja DNS un proteīnu galveno lomu kodolā.

Pusgadsimtu vēlāk, 1928. gadā, britu bakteriologs Frederiks Grifits ziņoja par pirmo baktēriju transformācijas demonstrāciju — procesu, kurā šūna uzņem ārējo DNS, tādējādi mainot tās morfoloģiju un fizioloģiju. Grifits veica savus eksperimentus ar Streptococcus pneumoniae, baktērija, kas izraisa pneimoniju. Grifits strādāja ar diviem šīs baktērijas celmiem, ko sauca par raupjo (R) un gludo (S). (Abus šūnu tipus sauca par "raupjiem" un "gludiem" pēc to koloniju parādīšanās, kas audzētas uz barības vielu agara plāksnes.)

R celms nav patogēns (neizraisa slimības). S celms ir patogēns (slimību izraisošs), un ārpus tā šūnas sienas ir kapsula. Kapsula ļauj šūnai izvairīties no saimniekpeles imūnreakcijām.

Kad Grifits pelēm injicēja dzīvo S celmu, tās nomira no pneimonijas. Turpretim, kad Grifits pelēm injicēja dzīvo R celmu, tās izdzīvoja. Citā eksperimentā, kad viņš pelēm injicēja karstumā nogalināto S celmu, tās arī izdzīvoja. Šis eksperiments parādīja, ka kapsula viena pati nebija nāves cēlonis. Trešajā eksperimentu komplektā pelēm tika injicēts dzīva R celma un karstumā nogalinātā S celma maisījums, un, viņam par pārsteigumu, peles nomira. Izolējot dzīvās baktērijas no mirušās peles, tika atgūts tikai baktēriju S celms. Kad šis izolētais S celms tika injicēts svaigām pelēm, peles nomira. Grifits secināja, ka kaut kas no karstumā nogalinātā S celma ir pārgājis dzīvajā R celmā un pārveidojis to par patogēno S celmu. Viņš to nosauca par pārveidošanas princips (2. attēls). Šie eksperimenti tagad ir pazīstami kā Grifita transformācijas eksperimenti.

2. attēls. Divi celmi no S. pneumoniae tika izmantoti Grifita transformācijas eksperimentos. R celms nav patogēns. S celms ir patogēns un izraisa nāvi. Kad Grifits injicēja peli ar karstumā nogalināto S celmu un dzīvu R celmu, pele nomira. S celms tika atgūts no mirušās peles. Tādējādi Grifits secināja, ka kaut kas ir pārgājis no karstumā nogalinātā S celma uz R celmu, pārveidojot R celmu par S celmu. (kredīts “living mouse”: darba modifikācijas, izmantojot NIH kredītu “dead mouse”: Sarah Marriage darba modifikācijas)

Zinātnieki Osvalds Eiverijs, Kolins Makleods un Maklins Makartijs (1944) bija ieinteresēti sīkāk izpētīt šo pārveidojošo principu. Viņi izolēja S celmu no mirušajām pelēm un izolēja proteīnus un nukleīnskābes (RNS un DNS), jo tie bija iespējamie iedzimtības molekulas kandidāti. Viņi izmantoja fermentus, kas īpaši noārdīja katru komponentu, un pēc tam izmantoja katru maisījumu atsevišķi, lai pārveidotu R celmu. Viņi atklāja, ka tad, kad DNS tika noārdīts, iegūtais maisījums vairs nespēja pārveidot baktērijas, bet visas pārējās kombinācijas spēja pārveidot baktērijas. Tas lika viņiem secināt, ka DNS ir transformējošais princips.

Kriminālistikas zinātnieki un DNS analīze

Tiesu medicīnas zinātnieki pirmo reizi izmantoja DNS analīzes pierādījumus, lai atrisinātu imigrācijas lietu. Stāsts sākās ar pusaugu zēna atgriešanos Londonā no Ganas, lai būtu kopā ar savu māti. Imigrācijas iestādēm lidostā pret viņu bija radušās aizdomas, jo viņš domāja, ka viņš ceļo ar viltotu pasi. Pēc ilgas pārliecināšanas viņam ļāva dzīvot pie savas mātes, taču imigrācijas iestādes neizbeidza lietu pret viņu. Iestādēm tika sniegti visa veida pierādījumi, tostarp fotogrāfijas, taču deportācijas process tomēr tika uzsākts. Aptuveni tajā pašā laikā Dr. Alec Jeffreys no Lesteras universitātes Apvienotajā Karalistē bija izgudrojis paņēmienu, kas pazīstams kā DNS pirkstu nospiedumu noņemšana. Imigrācijas iestādes vērsās pie doktora Džefrija pēc palīdzības. Viņš paņēma DNS paraugus no mātes un trim viņas bērniem, kā arī no nesaistītas mātes un salīdzināja paraugus ar zēna DNS. Tā kā attēlā nebija bioloģiskā tēva, trīs bērnu DNS tika salīdzināta ar zēna DNS. Viņš atrada atbilstību zēna DNS gan mātei, gan viņa trim brāļiem un māsām. Viņš secināja, ka zēns patiešām ir mātes dēls.

Tiesu medicīnas zinātnieki analizē daudzus priekšmetus, tostarp dokumentus, rokrakstu, šaujamieročus un bioloģiskos paraugus. Viņi analizē matu, spermas, siekalu un asiņu DNS saturu un salīdzina to ar zināmo noziedznieku DNS profilu datubāzi. Analīze ietver DNS izolāciju, sekvencēšanu un secību analīzi. Paredzams, ka tiesu medicīnas speciālisti ieradīsies tiesas sēdēs, lai iepazīstinātu ar saviem secinājumiem. Viņi parasti tiek nodarbināti pilsētu un valsts iestāžu noziedzības laboratorijās. Ģenētiķi, kas eksperimentē ar DNS metodēm, strādā arī zinātnes un pētniecības organizācijās, farmācijas nozarēs un koledžu un universitāšu laboratorijās. Studentiem, kuri vēlas turpināt karjeru kā tiesu medicīnas zinātnieks, ir jābūt vismaz bakalaura grādam ķīmijā, bioloģijā vai fizikā un, vēlams, zināmai pieredzei darbā laboratorijā.

Lai gan Eiverija, Makartija un Makleoda eksperimenti bija pierādījuši, ka DNS ir transformācijas laikā pārnestā informatīvā sastāvdaļa, DNS joprojām tika uzskatīta par pārāk vienkāršu molekulu, lai pārnēsātu bioloģisko informāciju. Olbaltumvielas ar to 20 dažādajām aminoskābēm tika uzskatītas par iespējamākiem kandidātiem. Izšķirošais eksperiments, ko 1952. gadā veica Marta Čeisa un Alfrēds Heršijs, sniedza apstiprinošus pierādījumus tam, ka DNS patiešām bija ģenētiskais materiāls, nevis olbaltumvielas. Čeiss un Heršijs pētīja bakteriofāgu — vīrusu, kas inficē baktērijas. Vīrusiem parasti ir vienkārša struktūra: proteīna apvalks, ko sauc par kapsīdu, un nukleīnskābes kodols, kas satur ģenētisko materiālu (DNS vai RNS). Bakteriofāgs inficē saimniekbaktēriju šūnu, pievienojoties tās virsmai, un pēc tam injicē savas nukleīnskābes šūnā. Fāga DNS veido vairākas sevis kopijas, izmantojot saimniekmehānismu, un galu galā saimniekšūna pārsprāgst, atbrīvojot lielu skaitu bakteriofāgu. Hershey un Chase izvēlējās radioaktīvos elementus, kas īpaši atšķirtu proteīnu no DNS inficētajās šūnās. Viņi marķēja vienu fāga partiju ar radioaktīvo sēru 35 S, lai marķētu proteīna apvalku. Cita fāgu partija tika marķēta ar radioaktīvo fosforu, 32 P. Tā kā fosfors ir atrodams DNS, bet ne proteīns, DNS, nevis proteīns tiks marķēts ar radioaktīvo fosforu. Tāpat sēra nav DNS, bet tas atrodas vairākās aminoskābēs, piemēram, metionīnā un cisteīnā.

Katrai fāga partijai tika atļauts inficēt šūnas atsevišķi. Pēc inficēšanās fāga baktēriju suspensija tika ievietota blenderī, kas izraisīja fāga apvalka atdalīšanu no saimniekšūnas. Pēc tam tika pārbaudītas šūnas, kas tika pakļautas pietiekami ilgi, lai notiktu infekcija, lai noskaidrotu, kura no divām radioaktīvajām molekulām ir iekļuvusi šūnā. Fāga un baktēriju suspensija tika izgriezta centrifūgā. Smagākās baktēriju šūnas nosēdās un veidoja granulu, bet vieglākās fāgu daļiņas palika supernatantā. Caurulē, kurā bija ar 35 S marķēts fāgs, supernatants saturēja radioaktīvi iezīmēto fāgu, savukārt granulā radioaktivitāte netika konstatēta. Caurulē, kurā atradās fāgs, kas marķēts ar 32 P, radioaktivitāte tika konstatēta granulā, kurā bija smagākas baktēriju šūnas, un supernatantā radioaktivitāte netika atklāta. Hershey un Chase secināja, ka tieši fāga DNS tika ievadīta šūnā un satur informāciju, lai ražotu vairāk fāgu daļiņu, tādējādi sniedzot pierādījumus tam, ka DNS ir ģenētiskais materiāls, nevis olbaltumvielas (3. attēls).

3. attēls. Hershey un Chase’ eksperimentos baktērijas tika inficētas ar fāgu, kas radioaktīvi iezīmēts ar 35S, kas iezīmē proteīnu, vai ar 32P, kas iezīmē DNS. Tikai 32P iekļuva baktēriju šūnās, norādot, ka DNS ir ģenētiskais materiāls.

Ap to pašu laiku austriešu bioķīmiķis Ervins Šargafs pētīja DNS saturu dažādās sugās un atklāja, ka adenīna, timīna, guanīna un citozīna daudzums nav atrasts vienādos daudzumos un ka četru nukleotīdu bāzu relatīvās koncentrācijas atšķiras atkarībā no sugas. sugām, bet ne viena un tā paša indivīda audos vai starp vienas sugas indivīdiem. Viņš arī atklāja kaut ko negaidītu: ka adenīna daudzums bija vienāds ar timīna daudzumu un citozīna daudzums bija vienāds ar guanīna daudzumu (tas ir, A = T un G = C). Dažādām sugām bija vienāds daudzums purīni (A+G) un pirimidīni (T + C), bet dažādas A+T un G+C attiecības. Šie novērojumi kļuva pazīstami kā Chargaff noteikumi . Chargaff’ atklājumi izrādījās ārkārtīgi noderīgi, kad Vatsons un Kriks gatavojās piedāvāt savu DNS dubultās spirāles modeli! Pēc dažu pēdējo lappušu izlasīšanas jūs varat redzēt, kā zinātne balstās uz iepriekšējiem atklājumiem, dažreiz lēnā un darbietilpīgā procesā.

Prakses jautājums

Hershey un Chase eksperimenti palīdzēja apstiprināt, ka DNS ir iedzimtības materiāls, pamatojoties uz konstatējumu, ka:

  1. granulā tika atrasts radioaktīvais fāgs
  2. supernatantā tika atrastas radioaktīvas šūnas
  3. šūnā tika atrasts radioaktīvais sērs
  4. šūnā tika atrasts radioaktīvais fosfors

Kopsavilkumā: DNS vēsture

DNS pirmo reizi no baltajām asins šūnām izdalīja Frīdrihs Mišers, kurš to sauca par nukleīnu, jo tā tika izolēta no kodoliem. Frederika Grifita eksperimenti ar celmiem Streptococcus pneumoniae sniedza pirmo mājienu, ka DNS var būt transformējošais princips. Eiveris, Makleods un Makartijs pierādīja, ka baktēriju transformācijai ir nepieciešama DNS. Vēlāk Hershey un Chase eksperimenti, izmantojot bakteriofāgu T2, pierādīja, ka DNS ir ģenētiskais materiāls. Chargaff atklāja, ka attiecība A = T un C = G un ka A, T, G un C procentuālais saturs dažādām sugām ir atšķirīgs.


Cilvēka herpesvīrusa 8 perifēro asiņu vīrusa slodzes un Kapoši sarkomas klīniskās stadijas saistība

Mērķis: Noteikt saistību starp cilvēka herpesvīrusa 8 (HHV-8 jeb ar Kapoši sarkomu saistītā herpesvīrusa) perifēro asiņu vīrusa slodzi un Kapoši sarkomas (KS) klīnisko stadiju.

Dizains: Aklā, šķērsgriezuma analīze par perifēro asiņu HHV-8 DNS līmeni personām ar AIDS saistītu KS Hararē, Zimbabvē.

Metodes: Subjekti tika stratificēti pēc KS klīniskās stadijas. HHV-8 DNS daudzums plazmas un perifēro asiņu mononukleārajās šūnās (PBMC) tika noteikts ar HHV-8 atvērtā nolasīšanas rāmja 26 kvantitatīvo reāllaika PCR pastiprināšanu.

Rezultāti: Tika pētīta 31 HIV-1/HHV-8 vienlaikus inficēta persona: 26 subjektiem bija histoloģiski apstiprināta KS (viena II stadija, 11 III stadija un 14 IV stadija) un pieciem subjektiem bija antivielas pret HHV-8, bet viņiem nebija KS. Vecums, CD4 limfocītu skaits un HIV-1 RNS līmenis plazmā bija līdzīgs visās grupās. HHV-8 DNS tika konstatēta visu ar HHV-8 inficēto subjektu plazmā (diapazons < 2,4 līdz 5,2 log10 kopijas/ml), bet plazmas HHV-8 DNS līmenis nebija saistīts ar KS slimības stadiju. Turpretim HHV-8 DNS daudzums PBMC (diapazons < 0,7 līdz 4,5 log10 kopijas/mikro) bija cieši saistīts ar KS klīnisko stadiju (P = 0,005). IV stadijas KS gadījumu vidū bija lineāra sakarība starp plazmas un PBMC HHV-8 DNS līmeni (r2 = 0,42 P = 0,01).

Secinājums: Spēcīgā saistība, kas novērota starp KS slimības izplatību un HHV-8 DNS līmeni PBMC, sniedz papildu pierādījumus par saistību starp HHV-8 vīrusa slodzi un KS patoģenēzi.


Vai inficēto personu asinīs ir nosakāms baktēriju DNS daudzums? - Bioloģija

Tā kā molekulārās metodes mikroorganismu identificēšanai un noteikšanai klīniskās mikrobioloģijas laboratorijā ir kļuvušas par rutīnu, ir jārisina jautājumi par šo metožu izmaksām un to ieguldījumu pacientu aprūpē. Molekulārā diagnoze ir vispiemērotākā infekcijas izraisītājiem, kurus ir grūti noteikt, identificēt vai savlaicīgi pārbaudīt uzņēmību ar parastajām metodēm.

Molekulārās bioloģijas rīki ir izrādījušies viegli pielāgojami izmantošanai klīniskās diagnostikas laboratorijā un solās būt ārkārtīgi noderīgi diagnostikā, terapijā un epidemioloģiskajos pētījumos un infekciju kontrolē.1,2). Lai gan tehniski jautājumi, piemēram, molekulāro testu veiktspējas vieglums, reproducējamība, jutīgums un specifiskums ir svarīgi, bažas rada arī izmaksas un iespējamais ieguldījums pacientu aprūpē (3). Molekulārās metodes daudzos veidos var būt uzlabojums salīdzinājumā ar parasto mikrobioloģisko testēšanu. Pašlaik to vispraktiskākais un noderīgākais pielietojums ir tādu infekcijas izraisītāju noteikšanā un identificēšanā, kuriem parastās uz augšanu balstītas kultūras un mikroskopijas metodes var nebūt piemērotas (47).

Uz nukleīnskābēm balstītos testos, ko izmanto infekcijas slimību diagnosticēšanai, tiek izmantotas standarta metodes nukleīnskābju izolēšanai no organismiem un klīniskā materiāla un restrikcijas endonukleāzes enzīmi, gēla elektroforēze un nukleīnskābju hibridizācijas metodes, lai analizētu DNS vai RNS (6). Tā kā mērķa DNS vai RNS klīniskajos paraugos var būt ļoti mazos daudzumos, infekcijas izraisītāju noteikšanai klīniskās diagnostikas laboratorijās ir izmantotas dažādas signāla pastiprināšanas un mērķa pastiprināšanas metodes.5,6). Lai gan nukleīnskābju sekvences analīze kopā ar mērķa pastiprināšanu ir galvenokārt pētniecības instruments, tā ir klīniski noderīga un palīdz atklāt un identificēt iepriekš nekultivējamus organismus un raksturot pretmikrobu rezistences gēnu mutācijas, tādējādi palīdzot gan diagnosticēt, gan ārstēt infekcijas slimības (5,8,9). Automatizācijai un augsta blīvuma oligonukleotīdu zondes blokiem (DNS mikroshēmām) ir arī liels solījums raksturot mikrobu patogēnus (6).

Lai gan lielākā daļa klīnicistu un mikrobiologu ar entuziasmu atzinīgi vērtē jaunos molekulāros testus infekcijas slimību diagnosticēšanai, šo testu augstās izmaksas rada bažas (3). Neraugoties uz varbūtību, ka uzlabots pacientu iznākums un samazinātas antimikrobiālo līdzekļu izmaksas un slimnīcas uzturēšanās ilgums atsvērs palielinātās laboratorijas izmaksas, kas rodas, izmantojot molekulāro testēšanu, šādus ietaupījumus ir grūti dokumentēt (3,10,11). Liela daļa izdevumu attaisnojumam par molekulāro testēšanu ir spekulatīvi (11), tomēr aprīkojuma, reaģentu un apmācīta personāla izmaksas ir reālas un ievērojamas, un atlīdzināšanas jautājumi ir problemātiski (3,11). Ņemot vērā šīs bažas, skartajiem klīniskajiem un laboratorijas dienestiem kritiski jāpārbauda objekta nepieciešamība pēc molekulārās diagnostikas testēšanas infekcijas slimībām. Daudzos gadījumos vispiemērotākā iespēja var būt rūpīga testu pasūtīšanas uzraudzība un saprātīga atsauces laboratorijas izmantošana.

Molekulāro metožu praktiskie pielietojumi klīniskās mikrobioloģijas laboratorijā

Komerciālie komplekti infekcijas patogēnu molekulārai noteikšanai un identificēšanai ir nodrošinājuši zināmu standartizācijas un lietošanas vienkāršības pakāpi, kas ir veicinājusi molekulārās diagnostikas ieviešanu klīniskās mikrobioloģijas laboratorijā (1. tabula). Nukleīnskābju zondu izmantošana kultivēto organismu identificēšanai un tiešai organismu noteikšanai klīniskajā materiālā bija pirmā iedarbība, kas lielākajai daļai laboratoriju bija jāveic komerciāli pieejamiem molekulāriem testiem. Lai gan šie zondes testi joprojām tiek plaši izmantoti, uz amplifikāciju balstītas metodes arvien vairāk tiek izmantotas, lai diagnosticētu, identificētu un noteiktu patogēnu daudzumu, kā arī raksturotu pretmikrobu zāļu rezistences gēnus. Dažiem patogēniem ir pieejami komerciāli amplifikācijas komplekti (1. tabula), bet dažiem klīniski svarīgiem patogēniem ir nepieciešamas pētnieka izstrādātas vai "mājas brūvēšanas" metodes (2. tabula). Turklāt molekulārā celma tipizēšana jeb genotipēšana ir izrādījusies noderīga, vadot terapeitiskus lēmumus attiecībā uz noteiktiem vīrusu patogēniem, kā arī epidemioloģiskai izmeklēšanai un infekciju kontrolei.2,12).

Patogēnu noteikšana un identificēšana bez mērķa pastiprināšanas

Ir pieejami komerciāli komplekti, kas satur neizotopiski marķētas nukleīnskābju zondes, lai tiešā veidā noteiktu patogēnus klīniskajā materiālā un identificētu organismus pēc izolēšanas kultūrā (1. tabula). Šķīduma fāzes hibridizācijas izmantošana ir ļāvusi testus veikt atsevišķi vai pa partijām pazīstamā mikroiedobes formātā.

Lai gan tieša organismu noteikšana klīniskajos paraugos ar nukleīnskābju zondēm ir ātra un vienkārša, tā cieš no jutīguma trūkuma. Lielākajai daļai tiešo zondes noteikšanas testu ir vajadzīgas vismaz 10 4 nukleīnskābes kopijas uz mikrolitru, lai nodrošinātu ticamu noteikšanu, un šī prasība reti tiek izpildīta klīniskajos paraugos bez jebkāda veida pastiprināšanas. Noteikšanas signāla pastiprināšana pēc zondes hibridizācijas uzlabo jutību līdz pat 500 gēnu kopijām mikrolitrā un nodrošina kvantitatīvās iespējas.Šī pieeja ir plaši izmantota vīrusu slodzes (HIV, B hepatīta vīrusa [HBV] un C hepatīta vīrusa [HCV]) kvantitatīvām pārbaudēm (1. tabula), taču tā neatbilst mērķa pastiprināšanas metožu, piemēram, polimerāzes, analītiskajai jutībai. ķēdes reakcija (PCR), organismu noteikšanai.

Komerciālās zondes sistēmas, kas izmanto šķīduma fāzes hibridizāciju un hemiluminiscenci tiešai infekcijas izraisītāju noteikšanai klīniskajā materiālā, ietver Gen-Probe PACE2 produktus un Digene un Murex hibrīda uztveršanas testu sistēmas (1. Šīs sistēmas ir lietotājam draudzīgas, tām ir ilgs glabāšanas laiks, un tās ir pielāgojamas mazam vai lielam paraugu skaitam. PACE2 produkti ir paredzēti tiešai Neisseria gonorrhoeae un Chlamydia trachomatis noteikšanai vienā paraugā (viens paraugs, divas atsevišķas zondes). Hibrīda uztveršanas sistēmas nosaka cilvēka papilomas vīrusu (HPV) dzemdes kakla skrāpējumos, herpes simplex vīrusu (HSV) vezikulu materiālā un citomegalovīrusu (CMV) asinīs un citos šķidrumos. Visi šie testi ir parādījuši jutību, kas pārsniedz kultūru vai imunoloģisko metožu jutīgumu attiecīgo patogēnu noteikšanai, bet ir mazāk jutīgi nekā PCR vai citas uz mērķa pastiprināšanu balstītas metodes.

Uz signāla pastiprināšanu balstītās zondes metodes vīrusu (HBV, HCV, HIV) noteikšanai un kvantitatīvai noteikšanai ir parādītas enzīmu imūntestam līdzīgā formātā un ietver sazarotās ķēdes DNS zondes (Chiron) un QB replikāzes (Gene-Trak) metodes (1. ). Šīs metodes nav tik jutīgas kā uz mērķa pastiprināšanu balstītas vīrusu noteikšanas metodes, tomēr kvantitatīvie rezultāti ir izrādījušies noderīgi vīrusu slodzes un prognozes noteikšanai, kā arī atbildes reakcijas uz terapiju uzraudzībai (13).

Zondes hibridizācija ir noderīga, lai identificētu lēni augošus organismus pēc izolēšanas kultūrā, izmantojot šķidru vai cietu barotni. Mikobaktēriju un citu lēni augošu organismu, piemēram, dimorfo sēņu (Histoplasma capsulatum, Coccidioides immitis un Blastomyces dermatitidis) identificēšanu noteikti ir atvieglojušas komerciāli pieejamās zondes. Visas komerciālās zondes organismu identificēšanai ražo Gen-Probe un izmanto ar akridīnija esteri iezīmētas zondes, kas vērstas uz sugai specifiskām rRNS sekvencēm (1. tabula). Gen-Probe produkti ir pieejami Mycobacterium tuberculosis, M. avium-intracellulare kompleksa, M. gordonae, M. kansasii, Cryptococcus neoformans, dimorfo sēņu (uzskaitītas iepriekš), N. gonorrhoeae, Staphylococcus pneumonia aureus, Streptoco. Escherichia coli, Haemophilus influenzae, Enterococcus spp., S. agalactiae un Listeria monocytogenes. Šo zondu jutība un specifika ir lieliska, un tās nodrošina sugu identificēšanu vienas darba dienas laikā. Tā kā lielāko daļu uzskaitīto baktēriju, kā arī C. neoformans, var viegli un efektīvi identificēt ar parastajām metodēm 1 līdz 2 dienu laikā, daudzas no šīm zondēm nav tikušas plaši izmantotas. No otras puses, mikobaktēriju zondes tiek pieņemtas kā galvenie M. tuberculosis un radniecīgo sugu identificēšanas līdzekļi (7).

Nukleīnskābju pastiprināšana

Nukleīnskābju amplifikācija nodrošina iespēju selektīvi pastiprināt specifiskus mērķus, kas atrodas zemā koncentrācijā, līdz nosakāmam līmenim, tādējādi uz amplifikāciju balstītas metodes piedāvā labāku veiktspēju jutīguma ziņā salīdzinājumā ar tiešajiem (nepastiprinātiem) zondes testiem. PCR (Roche Molecular Systems, Branchburg, NJ) bija pirmā šāda metode, kas tika izstrādāta, un tās elastības un vieglas veiktspējas dēļ joprojām ir visplašāk izmantotā molekulārās diagnostikas metode gan pētniecības, gan klīniskajās laboratorijās. Ir izstrādātas un komerciāli pieejamas vairākas dažādas uz pastiprināšanu balstītas stratēģijas (1. tabula). Komerciālās uz amplifikāciju balstītās infekcijas slimību molekulārās diagnostikas sistēmas galvenokārt ir vērstas uz N. gonorrhoeae, C. trachomatis, M. tuberculosis un specifisku vīrusu infekciju (HBV, HCV, HIV, CMV un enterovīrusu) noteikšanas sistēmām (1. tabula). Ņemot vērā PCR pielāgošanās spēju, ar pētnieku izstrādātiem vai mājās gatavotiem PCR testiem ir atklāti daudzi papildu infekciozi patogēni (5) (2. tabula). Daudzos gadījumos šādi testi sniedz svarīgu un klīniski nozīmīgu informāciju, kas citādi nebūtu pieejama, jo komerciālās intereses ir lēnas, paplašinot klīniskajām laboratorijām pieejamo produktu klāstu. Papildus kvalitatīvai vīrusu noteikšanai vīrusu slodzes kvantitatīvā noteikšana klīniskajos paraugos tagad ir atzīta par ļoti svarīgu HCV, HIV, HBV un CMV diagnostikā, prognozēšanā un terapeitiskajā uzraudzībā.13). Viena vai vairāku vīrusu kvantitatīvai noteikšanai ir pieejamas gan PCR, gan nukleīnskābju virknes balstītas amplifikācijas sistēmas (1. tabula).

Uz amplifikāciju balstītu testa metožu pielāgošana komerciāli pieejamiem komplektiem ir palīdzējusi optimizēt lietotāju pieņemamību, novērst piesārņojumu, standartizēt reaģentus un testēšanas apstākļus un padarīt automatizācijas iespēju. Nav skaidrs, cik lielā mērā atšķiras noteikšanas līmeņi, kas sasniedzami ar dažādām pastiprināšanas stratēģijām. Neviena no jaunākajām metodēm nenodrošina augstāku jutības līmeni par PCR. Izvēloties molekulārās diagnostikas sistēmu, jāņem vērā pieejamo testu klāsts, metodes piemērotība darbplūsmai un izmaksas (6). Noteikti ir praktiski izvēlēties vienu uz pastiprināšanu balstītu metodi, kas nodrošina testēšanas iespējas vairākiem patogēniem.

Uz amplifikāciju balstītas metodes ir vērtīgas arī kultivētu un nekultivējamu organismu identificēšanai (5). Amplifikācijas reakcijas var būt izstrādātas, lai ātri identificētu pret skābi izturīgu organismu kā M. tuberculosis vai var pastiprināt ģints specifisku vai "universālu" mērķi, ko pēc tam raksturo, izmantojot restrikcijas endonukleāzes gremošanu, hibridizāciju ar vairākām zondēm vai secības noteikšanu, lai nodrošinātu. sugas vai pat pasugas norobežošana (4,5,14). Lai gan sākotnēji identifikācija tika piemērota lēni augošām mikobaktērijām, tai ir pielietojums citiem patogēniem, kurus ir grūti vai neiespējami identificēt ar parastajām metodēm.

Antimikrobiālās rezistences noteikšana

Molekulārās metodes var ātri noteikt pretmikrobu zāļu rezistenci klīniskos apstākļos un ir būtiski veicinājušas mūsu izpratni par rezistences izplatību un ģenētiku (9). Tradicionālās uz buljonu un agaru balstītas pretmikrobu jutības pārbaudes metodes nodrošina fenotipisku profilu konkrēta mikroba reakcijai uz virkni aģentu. Lai gan tradicionālās metodes ir noderīgas potenciāli noderīgu terapeitisko līdzekļu atlasei, tās ir lēnas un ir saistītas ar problēmām. Visizplatītākā neveiksme ir meticilīna rezistences noteikšanā stafilokokiem, kas var izpausties ļoti neviendabīgi, apgrūtinot rezistences fenotipisku raksturojumu (9,15). Pašlaik rezistences gēna mec A molekulārā noteikšana ir standarts, pēc kura tiek vērtētas fenotipiskās metodes meticilīna rezistences noteikšanai (9,15,16).

Molekulārās metodes var izmantot, lai noteiktu specifiskus pretmikrobu zāļu rezistences gēnus (rezistences genotipēšanu) daudzos organismos (3. tabula) (8,9). Arvien svarīgāka ir arī specifisku punktu mutāciju noteikšana, kas saistītas ar rezistenci pret pretvīrusu līdzekļiem (17,18). Mutāciju skrīningu pastiprinātā produktā var atvieglot, izmantojot augsta blīvuma zondes blokus (gēnu mikroshēmas) (6).

Neskatoties uz daudzajām iespējamām priekšrocībām, genotipēšana tuvākajā nākotnē neaizstās fenotipiskās metodes antimikrobiālās rezistences noteikšanai klīniskajā laboratorijā. Rezistences noteikšanas molekulārās metodes var pielietot tieši klīniskajam paraugam, nodrošinot vienlaicīgu patogēna noteikšanu un identificēšanu, kā arī rezistences raksturojumu (9). Tāpat tie ir noderīgi, lai noteiktu rezistenci pret vīrusiem, lēni augošiem vai dzīvotnespējīgiem organismiem vai organismiem ar rezistences mehānismiem, kurus nevar droši noteikt ar fenotipiskām metodēm (9,19). Tomēr to augstās specifikas dēļ molekulārās metodes neatklās jaunus rezistences mehānismus un maz ticams, ka tās būs noderīgas rezistences gēnu noteikšanai sugās, kurās gēns iepriekš nav novērots (19). Turklāt rezistences gēna klātbūtne nenozīmē, ka gēns tiks ekspresēts, un zināma rezistences gēna neesamība neizslēdz rezistences iespējamību no cita mehānisma. Fenotipiskās antimikrobiālās jutības testēšanas metodes ļauj laboratorijām pārbaudīt daudzus organismus un atklāt jaunus, kā arī izveidotos rezistences modeļus.

Molekulārā epidemioloģija

attēls. Impulsa lauka gēla elektroforēzes (PFGE) profili Staphylococcus aureus izolātiem, kas sagremoti ar Sma 1. Šajos 23 izolātos ir parādīti dažādi PFGE profili.

Mikrobu patogēnu laboratoriskā raksturošana kā bioloģiski vai ģenētiski radniecīga bieži ir noderīga pētījumos (12,20,21). Mikrobu patogēnu pētījumos ir izmantotas vairākas dažādas epidemioloģiskās tipizēšanas metodes (4. tabula). Fenotipiskās metodes dažkārt ir bijušas noderīgas, aprakstot infekcijas slimību epidemioloģiju, tomēr tās ir pārāk mainīgas, lēnas un darbietilpīgas, lai tās varētu izmantot lielākajā daļā epidemioloģisko pētījumu. Jaunākas uz DNS balstītas tipizēšanas metodes ir novērsušas lielāko daļu šo ierobežojumu, un tagad tās ir ieteicamās metodes epidemioloģiskās tipēšanas noteikšanai. Visplašāk izmantotās molekulārās tipizēšanas metodes ietver plazmīdu profilēšanu, plazmīdu un genoma DNS restrikcijas endonukleāzes analīzi, Southern hibridizācijas analīzi, izmantojot specifiskas DNS zondes, un hromosomu DNS profilēšanu, izmantojot vai nu impulsa lauka gēla elektroforēzi (PFGE), vai uz PCR balstītas metodes (12,20). Visas šīs metodes izmanto elektriskos laukus, lai atdalītu DNS fragmentus, veselas hromosomas vai plazmīdas unikālos modeļos vai pirkstu nospiedumos, kas tiek vizualizēti, krāsojot ar etīdija bromīdu vai ar nukleīnskābes zondes hibridizāciju (attēls). Molekulārā tipizēšana tiek veikta, lai noteiktu, vai dažādi izolāti sniedz vienādus vai atšķirīgus rezultātus vienam vai vairākiem testiem. Epidemioloģiski saistītiem izolātiem ir vienāds DNS profils vai pirkstu nospiedumi, savukārt sporādiskiem vai epidemioloģiski nesaistītiem izolātiem ir izteikti atšķirīgi modeļi (attēls). Ja izolātiem no dažādiem pacientiem ir viens un tas pats pirkstu nospiedums, iespējams, tie ir cēlušies no viena klona un tika pārnesti no pacienta uz pacientu, izmantojot kopīgu avotu vai mehānismu.

Molekulārās tipizēšanas metodes ir ļāvušas pētniekiem izpētīt saistību starp izolātu kolonizāciju un inficēšanu atsevišķiem pacientiem, atšķirt piesārņojošos no inficējošiem celmiem, dokumentēt hospitalizētu pacientu transmisiju slimnīcā, novērtēt atkārtotu inficēšanos pret recidīvu pacientiem, kuri tiek ārstēti no infekcijas, un sekot pretmikrobu līdzekļu izplatībai. - zālēm rezistenti celmi slimnīcās un starp tām laika gaitā (12). Lielāko daļu pieejamo uz DNS balstīto tipēšanas metožu var izmantot nozokomiālo infekciju pētījumos, ja tās izmanto rūpīgas epidemioloģiskās izmeklēšanas kontekstā (12,21). Turpretim pat visspēcīgākā un sarežģītākā mašīnrakstīšanas metode, ja to izmanto bez izšķirības, ja nav pamatotu epidemioloģisko datu, var sniegt pretrunīgu un mulsinošu informāciju.

Finanšu apsvērumi

Infekcijas slimību molekulārā pārbaude ietver saimnieka noslieces uz slimībām pārbaudi, inficēto vai kolonizēto personu skrīningu, klīniski nozīmīgu infekciju diagnostiku un infekcijas gaitas vai konkrēta patogēna izplatības uzraudzību noteiktā populācijā. Bieži tiek pieņemts, ka papildus uzlabotai pacientu aprūpei no molekulārās testēšanas var gūt lielus finansiālus ieguvumus, jo testi samazina mazāk jutīgu un specifisku testu izmantošanu, nevajadzīgas diagnostikas procedūras un terapijas, kā arī nozokomiālās infekcijas (11). Tomēr molekulāro testēšanas metožu raksturīgās izmaksas kopā ar mainīgo un neatbilstošo trešo pušu maksātāju un pārvaldīto aprūpes organizāciju atlīdzību ir ierobežojušas šo testu ieviešanu klīniskās diagnostikas laboratorijā.

Ne visi molekulārās diagnostikas testi ir ārkārtīgi dārgi. Tiešās izmaksas ir ļoti atšķirīgas atkarībā no testa sarežģītības un sarežģītības. Lēti molekulārie testi parasti ir balstīti uz komplektiem, un tajos tiek izmantotas metodes, kurām nepieciešama neliela instrumentācija vai tehnologa pieredze. DNS zondes metodes, kas nosaka C. trachomatis vai N. gonorrhoeae, ir zemu izmaksu molekulāro testu piemēri. Sarežģītākiem molekulārajiem testiem, piemēram, rezistences genotipēšanai, bieži ir augstas darbaspēka izmaksas, jo tiem ir nepieciešami pieredzējuši, labi apmācīti tehnologi. Lai gan sarežģītākiem testiem var būt nepieciešams dārgs aprīkojums (piemēram, DNS sekvencētājs) un reaģenti, automatizācijas sasniegumi un lētāku reaģentu ražošana sola samazināt šīs izmaksas, kā arī tehniķa laiku. Galvenie šķēršļi molekulārās diagnostikas laboratorijas izveidei, kas bieži tiek apsvērti tikai procesa beigās, ir nepieciešamās licences, esošie un neapstiprinātie patenti, testu atlase, kā arī rēķinu izrakstīšana un atlīdzināšana (22).

Atlīdzināšanas jautājumi ir galvenais neskaidrību, neapmierinātības un nekonsekvences avots. Trešo pušu maksātāju veikto atlīdzību apgrūtina Pārtikas un zāļu pārvaldes (FDA) apstiprinājuma un pašreizējās procesuālās terminoloģijas (CPT) kodu trūkums daudziem molekulārajiem testiem. Kopumā infekcijas slimību molekulārie testi ir vairāk pieņemti atlīdzināšanai, tomēr atlīdzināšana bieži tiek veikta katrā gadījumā atsevišķi un var būt lēna un apgrūtinoša. FDA apstiprinājums testa veikšanai uzlabo iespēju, ka tas tiks atlīdzināts, bet nenodrošina, ka atmaksātā summa būs vienāda ar testa veikšanas izmaksām.

Iespējams, ka vairāk nekā citus laboratorijas testus molekulāros testus var negatīvi ietekmēt pārvaldītas aprūpes līgumi par pakalpojumu un vispārēja laboratorijas testu maksas atlaide. Šādu pasākumu rezultātā bieži tiek saņemta atlīdzība, kas ir zemāka par pārbaudes veikšanas izmaksām. Lai gan molekulāros testus var uzskatīt par līdzekli pacienta labsajūtas veicināšanai, pacienta labsajūtas finansiālos ieguvumus nav viegli realizēt īstermiņā (11). Šķiet, ka veselības uzturēšanas organizācijas (HMO) un pārvaldītās aprūpes organizācijas bieži darbojas īsākos termiņos, un to administratorus var neinteresēt diagnostikas testēšanas stratēģiju ilgtermiņa ietekme.

Infekcijas slimību molekulārās skrīninga programmas tiek izstrādātas, lai noteiktu simptomātiskas un asimptomātiskas slimības indivīdiem un grupām. Personas, kurām ir augsts risks, piemēram, pacienti ar novājinātu imūnsistēmu vai ģimenes plānošanas vai dzemdību klīnikas apmeklētāji, tiek pārbaudīti attiecīgi attiecībā uz CMV un hlamīdiju. Tāpat visi asins donori tiek pārbaudīti, lai noteiktu ar asinīm pārnēsātus patogēnus. Šādas pārbaudes finansiālais rezultāts nav zināms. Izmaksām jābūt līdzsvarotām ar ieguvumiem no agrākas diagnostikas un ārstēšanas, kā arī tādiem sabiedriskiem jautājumiem kā slimību epidemioloģija un populācijas pārvaldība.

Viens no visvairāk reklamētajiem ieguvumiem no infekcijas slimību molekulārās testēšanas ir solījums agrāk noteikt noteiktus patogēnus. M. tuberculosis ātra noteikšana tieši klīniskajos paraugos ar PCR vai citām uz amplifikāciju balstītām metodēm, visticamāk, ir rentabla tuberkulozes ārstēšanā.7). Citi infekcijas slimību piemēri, kurām var veikt molekulāro diagnozi un kuru pārvaldību var uzlabot ar šo tehnoloģiju, ir HSV encefalīts, Helicobacter pylori infekcija un Borrelia burgdorferi izraisītā neiroborelioze. HSV encefalīta gadījumā HSV noteikšana cerebrospinālajā šķidrumā (CSF) var virzīt specifisku terapiju un novērst citus testus, tostarp smadzeņu biopsiju. Tāpat H. pylori noteikšana kuņģa šķidrumā var virzīt terapiju un novērst endoskopijas un biopsijas nepieciešamību. B. burgdorferi PCR noteikšana CSF palīdz atšķirt neiroboreliozi no citiem hroniskiem neiroloģiskiem stāvokļiem un hroniska noguruma sindroma.

Kā minēts iepriekš, molekulāros testus var izmantot, lai prognozētu slimības reakciju uz specifisku pretmikrobu terapiju. Specifisku rezistences gēnu (mec A, van A) vai punktu mutāciju noteikšana, kas izraisa rezistenci, ir izrādījusies efektīva slimības pārvaldībā. Molekulārā vīrusu slodzes pārbaude ir kļuvusi par standarta praksi pacientiem ar hronisku hepatītu un AIDS. Vīrusu slodzes pārbaude un HCV genotipa noteikšana ir noderīga, lai noteiktu dārgas terapijas, piemēram, interferona, lietošanu, un tos var izmantot, lai pamatotu lēmumus par terapijas apjomu un ilgumu. Ar AIDS vīrusu slodzes noteikšana un rezistences genotipa noteikšana ir izmantota, lai atlasītu dažādas ārstēšanai pieejamās proteāzes inhibitoru zāles, uzlabojot pacienta reakciju un samazinot oportūnistisko infekciju sastopamību.

Farmakogenomika ir molekulāro testu izmantošana, lai prognozētu reakciju uz specifiskām terapijām un uzraudzītu slimības reakciju uz ievadītajiem līdzekļiem. Labākie infekcijas slimību farmakogenomikas piemēri ir vīrusu slodzes un rezistences genotipa izmantošana, lai izvēlētos un uzraudzītu AIDS un hroniska hepatīta pretvīrusu terapiju (17,18). Šī lietojumprogramma uzlabo slimības iznākumu, saīsina slimnīcas uzturēšanās ilgumu, samazina nevēlamos notikumus un toksicitāti un atvieglo rentablu terapiju, izvairoties no nevajadzīgām dārgām zālēm, optimizējot devas un laiku, kā arī novēršot neefektīvas zāles.

Mikroorganismu molekulāro celmu tipizēšana tagad ir plaši atzīta par būtisku sastāvdaļu visaptverošā infekciju kontroles programmā, kas ietver arī infekciju kontroles nodaļu, infekcijas slimību nodaļu un aptieku.10,21). Molekulārās metodes klonalitātes esamības vai neesamības noteikšanai ir efektīvas, lai izsekotu nozokomiālo infekciju izplatībai un racionalizētu infekciju kontroles programmas aktivitātes (21,23). Visaptverošā infekciju kontroles programmā tiek izmantota gan infekciju kontroles praktiķu, gan klīniskās mikrobioloģijas laboratorijas aktīva uzraudzība, lai identificētu infekciju kopas ar kopīgu mikrobu fenotipu (tā pati suga un pretmikrobu jutības profils). Pēc tam izolātus raksturo laboratorijā, izmantojot vienu no vairākām molekulārās tipizēšanas metodēm (4. tabula), lai apstiprinātu vai atspēkotu klonalitāti. Pamatojoties uz pieejamajiem epidemioloģiskajiem un molekulārajiem datiem, slimnīcas epidemiologs izstrādā intervences stratēģiju. Molekulārā tipizēšana var saīsināt vai novērst epidēmiju (23) un samazināt nozokomiālo infekciju skaitu un izmaksas (5. tabula) (10). Haceks et al. (10) analizēja medicīniskos un ekonomiskos ieguvumus no infekciju kontroles programmas, kas ietvēra mikrobu klonitātes regulāru noteikšanu, un atklāja, ka nozokomiālās infekcijas ir ievērojami samazinājušās un 2 gadu laikā tika ietaupīti vairāk nekā 4 miljoni ASV dolāru (5. tabula).

Molekulārās testēšanas patiesā finansiālā ietekme tiks realizēta tikai tad, ja testēšanas procedūras tiks integrētas kopējā slimības novērtējumā. Dārgākas testēšanas procedūras var būt pamatotas, ja tās samazina mazāk jutīgu un mazāk specifisku testu izmantošanu un novērš nevajadzīgas diagnostikas procedūras un neefektīvas terapijas.

Dr.Pfallers ir Aiovas Universitātes Medicīnas koledžas un Sabiedrības veselības koledžas Molekulārās epidemioloģijas un sēnīšu testēšanas laboratorijas profesors un direktors. Viņa pētījumi ir vērsti uz nozokomiālo infekciju epidemioloģiju un pretmikrobu zāļu rezistenci.


Slimību diagnostikas un ārstēšanas molekulārais pamats (ar diagrammu)

Slimību molekulārā nozīmē var definēt kā jebkuru anomāliju dzīvajā sistēmā. Anomālijas var izraisīt vīrusu, baktēriju, sēnīšu, parazītu, olbaltumvielu vai mazu molekulu infekcija cilvēkos, dzīvniekos, augos, ūdenī un augsnē. Anomālija var rasties arī šūnu molekulārās struktūras izmaiņu dēļ. Piemēram, izmaiņas DNS secībā, ko sauc par mutāciju, var izraisīt dažādus traucējumus/slimības.

Šo slimību profilakse un ārstēšana ir iespējama tikai tad, ja slimības izraisītāju var noteikt atbilstošā laikā. Līdz šim šo slimību diagnostikā un ārstēšanā tika izmantotas daudzas dārgas un darbietilpīgas klīniskas procedūras. Attīstoties molekulārajai biotehnoloģijai, tagad šo slimību diagnostikā un arī ārstēšanā tiek izmantotas dažādas molekulārās diagnostikas metodes.

Molekulārā diagnostika:

Diagnostikas tests var būt efektīvs tikai tad, ja:

a) raksturīgs mērķa molekulai

b) jutīga, lai noteiktu pat nelielus mērķa līmeņus un

Ir divas molekulārās diagnostikas metožu klases:

(1) DNS noteikšanas metodes, kas izmanto nukleīnskābju hibridizāciju vai polimerāzes ķēdes reakciju, lai noteiktu noteiktu nukleīnskābju secību.

(2) Imunoloģiskās metodes — ir balstītas uz antivielas specifiskumu konkrētam antigēnam.

1. DNS noteikšanas metodes.

Ir izstrādātas dažādas metodes dažādu slimību un kautrību noteikšanai, pamatojoties uz DNS secību, kas izveidota īpašā veidā.

Dažas šeit apspriestās metodes ir:

a) patogēna organisma noteikšana ar nukleīnskābju hibridizāciju

b) ģenētiskas slimības diagnostika, izmantojot restrikcijas endonukleāzi

c) ģenētiskas slimības diagnostika ar P.C.R./oligonukleotīdu ligācijas testu (PCR/OLA) un

d) mutantu noteikšana dažādās vietās vienā gēnā.

a) patogēna organisma noteikšana ar nukleīnskābju hibridizāciju:

Slimību izraisošo (patogēnu un kautrīgo) organismu var ļoti specifiski noteikt bioloģiskajos paraugos ar nukleīnskābju hibridizāciju, ti, ja slimību izraisošā organisma nukleīnskābju secība atrodas asinīs, urīnā, izkārnījumos utt., tad to var hibridizēt ar nukleīnskābes zonde, kas ir komplementāra šīs mērķa nukleīnskābes secībai. Ja pato&higēnais organisms atrodas bioloģiskajā paraugā, notiek hibridizācija, un, ja nē, hibridizācija nenotiek.

Parazīts Plasmodium falciparum izraisa malāriju cilvēkiem. Konkrēts gēns (tātad tā produkts) ir šī parazīta izraisītājs. Šim gēnam komplementāru DNS zondi ķīmiski sintezē ar radioaktīvi iezīmētu 32 P. Šī zonde ir saistīta ar membrānas balstu. Pēc tam atbilstošos temperatūras un jonu stipruma apstākļos pievieno analizējamo bioloģisko paraugu, lai veicinātu bāzes savienošanos starp zondi un mērķa DNS paraugā.

Pēc tam to mazgā, lai noņemtu parauga pārpalikumu, un pēc tam ekstrahē hibridizēto divpavedienu DNS un hibrīdās sekvences nosaka ar autoradiogrāfiju. Izvēlētā specifiskā DNS zonde hibridizēsies tikai ar P. falciparum, bet ne ar P. vivax, P. cyanomolgi vai cilvēka DNS. Šī zonde var noteikt tikai 10 pikogrammas attīrītas P. falciparum DNS vai 1 nanogramu P. falciparum DNS asins paraugos. Ja ir notikusi hibridizācija, tad patogēnais organisms ir klāt, un, ja hibridizācija nenotiek (t.i., nav starojuma), tad patogēnā organisma nav.

Iepriekš minētā procedūra ir piemērota visu patogēno organismu noteikšanai jebkurā bioloģiskajā paraugā. Šeit radioaktīvā fosfora izmantošanas trūkums ir tas, ka tas ir bīstams, tāpēc mūsdienās tiek izmantotas neradioaktīvās hibridizācijas procedūras. Šajā metodē visa DNS no parauga tiek ekstrahēta un piesaistīta balstam, pēc tam ar biotīnu iezīmētā DNS zonde, kas ir komplementāra ar patogēna DNS, tiek hibrīda un nomierināta ar mērķa DNS.

Pēc tam pievieno avidīnu vai streptavidīnu, kas saistās ar biotīnu uz hibridizētās zondes mērķa DNS. Pēc tam tiek pievienots ar biotīnu iezīmēts enzīms, piemēram, sārmaina fosfatāze, kas saistās ar avidīnu, kas saistīts ar zondi. Pēc tam pievieno šim fermentam specifisko substrātu, kas bezkrāsaino substrātu pārvērš krāsainā produktā. Krāsas izskats norāda uz patogēnās DNS klātbūtni, bet krāsas neveidošanās liecina par organisma neesamību.

b) ģenētiskas slimības diagnostika, izmantojot restrikcijas endonukleāzi:

Sirpjveida šūnu anēmija ir ģenētiska slimība, ko izraisa viena nukleotīda izmaiņas hemoglobīna molekulas beta ķēdes sestās aminoskābes kodonā. Beta-globīna gēns normāliem cilvēkiem ir apzīmēts kā A/A, heterozigotiem indivīdiem kā A/a un homozigotiem indivīdiem kā S/s. Personas, kas satur sirpjveida gēnu, tiek pārbaudītas pirms simptomu izpausmes un pārnēsātāja skrīninga, kurām ir risks pārnest šo gēnu saviem pēcnācējiem.

Noteikšanas princips ir tāds, ka normāla indivīda beta-globīna gēnā ir trīs restrikcijas endonukleāzes Cvn-1 vietas, bet sirpjveida šūnu gēnā viena no šīm vietām tiek zaudēta viena nukleotīda aizstāšanas dēļ. .

Parastā gēnā DNS secība ir CCTGAGG, savukārt sirpjveida šūnu anēmijas gēnā secība ir CCTGTGG. Turklāt Cvn-1 atpazīšanas secība un šķelšanās vieta ir CCTNAGG. Tādējādi šīs DNS diagnozes pamatā ir atšķirība normālo un sirpjveida šūnu gēna secībā Cvn-1 atpazīšanas vietā.

Tiek pievienoti divi praimeri ar sekvencēm, kas var savienoties pāros Cvn-1 vietās beta-globīna gēnā, un šī DNS daļa tiek pastiprināta, izmantojot P.C.R. un pēc tam sagremots ar Cvn-1. Visbeidzot šķelšanās produkti tiek atdalīti ar gēla elektroforēzi un iekrāsoti ar etīdija bromīdu.

Rezultāti liecina, ka normālā gēnā tiek iegūti četri DNS fragmenti ar 88, 181, 201 un 256 bāzes pāriem. Bet heterozigotā indivīdā tiek iegūti pieci DNS fragmenti, kas satur 88, 181, 201, 256 un 382 bāzes pārus, bet homozigotiem indivīdiem iegūti tikai trīs fragmenti ar 88, 256 un 382 nukleotīdu bāzes pāriem, kas norāda uz vienas no atpazīšanas vietas zudumu. sirpjveida šūnu gēns.

c) ģenētiskas slimības diagnostika ar PCR/OLA procedūru:

Šo procedūru piemēro tiem traucējumiem ģenētisko mutāciju dēļ, kas neietekmē restrikcijas endonukleāzes vietas. Ņemsim par piemēru gēnu, kurš ir piedzīvojis mutāciju 98. pozīcijā. Šajā konkrētajā vietā normālā gēna bāzes pāris ir C=G un mutanta gēnā lai tas ir A=T.

Divi aptuveni 20 nukleotīdu gari oligonukleotīdi tiek sintezēti ar secību, kas komplementāra vienai no šī gēna virknēm abās 98. pozīcijas pusēs. Vienam no šiem oligonukleotīdiem 5′ galā ir biotīns un gala nukleotīds ir ‘C’. 3′ galā. Otrai oligonukleotīda zondei ir ‘A’ bāzes nukleotīds 5′ galā un digoksigenīns (savienojums ‘D’) tā 3′ galā.

Mērķa DNS pastiprina ar PCR un pēc tam hibridizē ar sintezētajām zondēm. Abas zondes bāzes pāri ir tā, ka 2. zondes 5′ gals atrodas blakus 1. zondes 3′ galam. Pēc tam pievieno DNS ligāzi, kas ligēs tikai parasto DNS fragmentu, bet ne ar zondēm hibridizēto mutācijas fragmentu.

Tas ir saistīts ar neatbilstību starp 2. zondi un mutācijas gēnu, kas nevar izveidot bāzes pāri. Turklāt, lai noteiktu, vai ligēšana ir notikusi vai nē, hibrīdzondes ievieto iedobē, kurā ir avidīns, kas saistās ar biotīnu. Pēc tam to mazgā, kas noņem nesaistīto zondi.

Pēc tam pievieno anti-digoksigenīna (‘D’ savienojuma) antivielu un sārmainās fosfatāzes konjugātu un mazgā abās iedobēs (normālās un mutācijas hibridizētās zondes). Paredzams, ka antivielu enzīms saistīsies tikai ar ligēto zondi. Pievienojot substrātu, krāsainais produkts tiek ražots tikai tajā akā, kurā ir notikusi nosiešana, turpretim krāsa neveidojas, ja nav notikusi liģēšana.

d) mutāciju noteikšana dažādās vietās vienā gēnā:

Beta-talasēmija ir ģenētiska slimība, ko izraisa beta-globulīna mutācija astoņās vai vairāk vietās, tādējādi radot zemu tā sintēzes ātrumu. Tādējādi tā vietā, lai noteiktu katru mutāciju atsevišķi, visas astoņas vietas tiek skenētas vienlaikus.

DNS zondes tiek sintezētas visās šajās astoņās beta-globīna gēna vietās, kur ir sagaidāmas mutācijas. Katra zonde ir 20 nukleotīdu garumā ar poli T’ asti 3′ galā. To izmanto, lai piestiprinātu zondi pie membrānas. Parauga DNS (beta-gēna) segmenti, kas ietver katru no iespējamām mutantu vietām, tiek pastiprināti ar PCR, izmantojot primerus, kas marķēti ar biotīnu 5′ galā.

Pēc tam amplificētā mērķa DNS tiek hibrīds un nomierināts ar membrānām piesaistītajām zondēm apstākļos, kas ļauj hibridizēties tikai perfektām sakritībām. Pēc tam pievieno streptavidīnu ar pievienotu sārmaino fosfatāzi, nomazgā membrānu un pievieno bezkrāsainu substrātu.

Krāsains plankums uz membrānas parādās visur, kur ir perfekta nukleotīdu atbilstība starp pastiprināto mērķa DNS segmentu un vienu no specifiskajām oligonukleotīdu zondēm. Vietās, kur nav hibridizācijas un shytion (mutantu DNS segmenti), krāsa neparādās. Tālāk sniegtajā ilustrācijā 1. un 2. gēns ir mutēti, bet 3. gēns ir normāls. (attēlā attēlota attiecīgi kā zonde 1, 2 un 3).

2. Imunoloģiskās metodes:

Antivielu molekulas sastāv no četrām ķēdēm, divām identiskām vieglajām ķēdēm un divām identiskām smagajām ķēdēm. Katras antivielas molekulas fv (fragmenta mainīgais) reģions cieši saistās ar noteiktu vietu (epitopu) uz antigēna. Šo specifiku izmanto, lai noteiktu slimību izraisošas molekulas vai organisma konkrēta epitopa klātbūtni bioloģiskā paraugā. Ir divas metodes, ar kurām nosaka antigēna-antivielu reakciju vai saistīšanos.

a) Radioimūno tests (RIA):

Progesterona koncentrācija asinīs (piemēram), ir jānosaka ar RIA. Vispirms tiek izaudzētas antivielas pret progesteronu un ņemtas mēģenē, kurā ir stikla lodītes. Antivielas viegli pievienojas stikla pērlītēm. Tad šai mēģenei pievieno progesteronu saturošu paraugu, kas saistās ar antivielām, veidojot antigēna-antivielu kompleksu, kura koncentrācija un koncentrēšanās ir atkarīga no progesterona daudzuma asins paraugā.

Tiek ņemta cita mēģene, un antivielas tiek marķētas ar radioaktīviem savienojumiem, piemēram, 123I vai 3H vai 14C. Šo radioaktīvi iezīmēto antivielu pēc tam pievieno pirmajai mēģenei, kas satur progesteronu, kas pievienots nemarķētām antivielām. Radio iezīmētās antivielas tagad pievienosies progesteronam un veidos iezīmētu antigēna-antivielu kompleksu, ko mēra, izmantojot scintilācijas skaitītāju.

b) Ar enzīmu saistīts imūnsorbcijas tests (ELISA):

Paraugu, kas jāpārbauda attiecībā uz noteiktas molekulas vai organisma klātbūtni, piesien pie cieta balsta, piemēram, plastmasas plāksnes. Pēc tam piesaistītajam materiālam pievieno marķierspecifisku antivielu (primāro antivielu) un pēc tam nesēju mazgā, lai noņemtu nesaistīto primāro antivielu.

Pēc tam pievieno otru antivielu (sekundāro antivielu), kas specifiski saistās ar primāro antivielu, nevis mērķa molekulu. Sekundārā antiviela satur saistītu enzīmu, piemēram, sārmaino fosfatāzi, kas katalizē bezkrāsaina substrāta pārvēršanos krāsainā produktā. Sistēma tiek vēlreiz mazgāta, lai noņemtu jebkādu nesaistītu sekundāro antivielu-enzīma kon­jugātu.

Pēc tam tiek pievienots bezkrāsains substrāts, kas tiek pārveidots par krāsainu produktu tikai tad, ja ir klāt konkrētais antigēns, ja nav, tad nav krāsas. Ja antigēna (vai izraisītāja) nav, primārā antiviela nesaistīsies ar mērķa vietu paraugā, tāpēc pirmajā mazgāšanas posmā tā tiek noņemta. Līdz ar to sekundārajam antivielu-enzīmu konjugātam nebūs ar ko saistīties, un tas tiek noņemts otrajā mazgāšanas posmā, un gala maisījums paliek bezkrāsains.

Un otrādi, ja paraugā atrodas antigēns (vai izraisītājs) vai mērķa vieta, tad primārā antiviela saistās ar to, sekundārā antiviela saistās ar primāro antivielu un piesaistītais enzīms katalizēs reakciju no krāsaina produkta. ko var noteikt kolorimetriski.

Molekulārā ārstēšana vai gēnu terapija:

Lai ārstētu ģenētisku slimību, šīs slimības parastais gēns ir jāsekvenē un jāklonē. Šo klonēto normālo gēnu var izmantot, lai labotu defektu indivīdiem, kuriem ir šī gēna mutācijas forma. Šeit mērķis ir bojātām šūnām pievienot normāli funkcionējošu gēnu, tādējādi nodrošinot nepieciešamo proteīnu un koriģējot ģenētisko slimību. Turklāt dažu slimību gadījumā būs jānovērš pārmērīga deregulēta normāla gēna ekspresija.

Ir trīs ģenētisko slimību terapijas metodes:

(2) In vivo gēnu terapija un

A) Ex vivo gēnu terapija:

Tiek savāktas skartās personas somatiskās šūnas. Izolētās šūnas audzē kultūrā. Pēc tam šīs šūnas tiek transfekētas ar retrovīrusu klonēšanas vektoriem, kas satur ārstnieciskā gēna konstrukciju. Šūnas tiek tālāk audzētas un tās šūnas, kas satur interesējošo gēnu, tiek atlasītas un visbeidzot transplantētas vai pārlietas atpakaļ pacientam. Šīs transplantētās transficētās šūnas sintezēs gēnu produktu, t.i., proteīnu. Šāda veida ārstēšanas piemēri ir gauše slimība, sirpjveida šūnu anēmija, talasēmija utt.

(b) In vivo gēnu terapija:

Šāda veida ārstēšanā tiek veikta tieša ārstnieciskā gēna ievadīšana konkrēta pacienta audu šūnās, izmantojot retrovīrusu vektorus. Pat plazmīdas DNS konstrukcijas
tiek izmantoti. Šo ārstēšanas veidu izmanto muskuļu distrofijas, neironu deģenerācijas un smadzeņu vēža slimniekiem.

(c) Antisense terapija:

Antisense terapija ir paredzēta, lai novērstu vai pazeminātu noteikta gēna ekspresiju. Dažu ģenētisko slimību un vēža veidu gadījumā gēni ir deregulēti vai pārmērīgi izteikti, kā rezultātā rodas gēnu produkta pārpalikums vai tā nepārtraukta klātbūtne šūnā traucēs normālu šūnas darbību.

Šāda veida slimību gadījumā normāla gēna pievienošana problēmu neatrisinās, tā vietā noderēs gēnu produkta (olbaltumvielu) sintēzes bloķēšana. Tādējādi antisensu terapijā mērķa šūnā tiek ievadīta nukleīnskābes sekvence, kas ir komplementāra šīs specifiskās mRNS pilnīgai vai daļai.

Tādējādi mRNS, kas iegūta ar normālu gēna transkripciju, hibridizēsies ar antisensu oligonukleotīdu, savienojot bāzi, tādējādi novēršot šīs mRNS translāciju, kā rezultātā samazinās mērķa proteīna daudzums. Antisensu terapiju izmanto dažādu vēža veidu, AIDS, aterosklerozes, leikēmijas un sirpjveida šūnu anēmijas ārstēšanā.


Rezultāti

Pacienta īpašības

Jaundzimušajiem neinficētajā grupā bija vidējais dzimšanas svars 1774 g, gestācijas vecums 32 nedēļas un vidēji 20 katetra dienas. Inficētās grupas (ar CLABSI) vidējais dzimšanas svars bija 1454 g, gestācijas vecums 30 nedēļas un vidēji 24 katetra dienas. Visi jaundzimušie, izņemot vienu, saņēma ārstēšanu ar antibiotikām ar vidējo ilgumu 8 dienas grupām, kas nebija CLABSI, un 11 dienas CLABSI grupās. Ampicilīns un gentamicīns tika lietoti atsevišķi vai kombinācijā ar citām antibiotikām attiecīgi 97 un 93% no visiem subjektiem (skatīt 1. un S1 tabulu).

Asins kultūra izolē

Visbiežākais organisms, kas tika izolēts ar asins kultūru 3 dienu laikā pēc katetra noņemšanas, bija koagulāzes negatīvi stafilokoki (CONS) (9/30, 30%), kam sekoja Staphylococcus aureus (4/30, 13.3%). S. epidermidis bija galvenais CONS (5/9, 55,5%), kas izolēts no asins kultūras (sīkāka informācija S1 tabulā).

16S V4 rRNS sekvencēšanas izvade

2. tabulā sniegts pētījumam apstrādāto un analizēto paraugu kopsavilkums. Sekvences rezultātu kopsavilkums, tostarp nolasījumu skaits, kvalitātes rādītāji un OTU skaits, ir parādīts 3. tabulā. No mūsu paraugiem iegūtajiem neapstrādātajiem datiem (n = 90) bija vidēji 32 539 nolasījumi paraugā ar ≥Q30 kvalitātes rādītāju. 64% (sk. 3. tabulu). Tomēr kopā 7516 lasījumi (lasīšanas diapazons: 1–354), kas pieder pie 187 dažādiem OTU (OTU pārpilnības diapazons: 1–2291), kas piešķirti kā “kingdom_bacteria”, tika raksturoti kā “neklasificētas_baktērijas” patvēruma līmenī, izmantojot iepriekš aprakstīto pielāgoto cauruļvadu. .

Negaidīti tika konstatēts, ka visi OTU, kas piešķirti kā “kingdom_bacteria phylum_unclassified_bacteria”, nav baktēriju nolasījumi, un gandrīz visi no tiem ir saskaņoti ar cilvēka DNS, izmantojot NCBI nr / nt un cilvēka genoma un transkripta datu bāzes. Tādējādi mēs no pakārtotās analīzes noņēmām OTU, kuras nevarēja klasificēt kā baktērijas valstības līmenī, un neklasificētos OTU patvēruma līmenī. Pēc neklasificēto OTU noņemšanas gan karaļvalsts, gan patvēruma līmenī tikai 44 (no 90) paraugiem tika iegūts izmantojams daudzums kvalitatīvi filtrētu secības datu (>100 nolasījumu paraugā), kopā 406 007 nolasījumus, kas pieder 440 dažādiem OTU.

Piemērošana dekontam R-pakete

Kopumā 28 OTU tika identificēti kā piesārņotāji pēc biežuma dekontam klasifikācija pēc noklusējuma sliekšņa (0,1) (sīkāku informāciju skatiet S2 tabulā un S1 attēlā). Piemērošana dekontam statistiskā metode mūsu paraugiem (n = 44, katrs ar >100 nolasījumiem paraugā) ļāva iegūt vidēji 9122 nolasījumus paraugā (diapazons: 96–45 180), kas tika piešķirti 412 dažādiem OTU (3. tabula). Pakārtotā analīze, tostarp baktēriju daudzveidība un sastāvs, tika novērtēta piesārņotāju noņemto datu kopā.

Baktēriju slodze

Paraugi no inficētiem katetriem (n = 14) saturēja ievērojami lielāku baktēriju slodzi (zems sliekšņa cikls (CT)) nekā neinficētie katetri (n = 12), mērot, izmantojot 16S rRNS gēnu qPCR (Mann-Whitney tests p<0,05) ( 1. att.). Visas negatīvās kontroles (trīs kreisās paraugu komplekti 1. attēlā) uzrādīja augstas CT vērtības, kas liecina par zemu 16S rRNS gēna saturu. Turpretim izkārnījumu paraugos, ko izmantoja kā pozitīvās kontroles, bija augsta baktēriju DNS koncentrācija (zema CT), kā paredzēts (labākais paraugs 1. attēlā). Baktēriju slodze bija arī ievērojami augstāka gan inficētos, gan neinficētos katetros nekā ūdens un buferšķīduma kontrolē (Kruskal Wallis ar Dunn post-hoc testu p<0,05). Netika konstatēta būtiska atšķirība baktēriju daudzumā starp inficētām un neinficētām ādas uztriepēm (Mann-Whitney tests p>0,05). Arī starp ādas uztriepju paraugiem un negatīvajām kontrolēm nebija būtisku atšķirību (Kruskal Wallis ar Dunn's post-hoc testu p>0,05). Mēs neveicām statistisku baktēriju slodzes salīdzinājumu starp inficētiem un neinficētiem asins paraugiem mazā parauga lieluma dēļ.16S qPCR rezultāts bija līdzīgs Qubit rezultātam (mērīts, izmantojot PCR pastiprinātu 16S V4 rRNS gēnu) (skatīt S2 attēlu).

qPCR analīze par baktēriju 16S rRNS gēnu pārpilnību dažādos pētītajos paraugos. Ievērojami augstāks baktēriju DNS līmenis tika atklāts inficētajos katetros (n = 14), salīdzinot ar neinficētajiem katetriem (n = 12) (Mann-Whitney tests p<0,05). *lpp<0,05, ns = nenozīmīgs (p>0,05). Cath = katetrs, U = neinficēts, I = inficēts.

Mikrobioma alfa daudzveidība no katetra, asins un ādas uztriepes

Alfa daudzveidība paraugos tika mērīta piesārņotāju noņemtajā datu kopā, kas tika samazināta līdz vienmērīgam paraugu ņemšanas dziļumam (katetrs = 165 sekvences, asinis = 137 un ādas tampons = 96). Nebija statistiski nozīmīgas atšķirības (Manna-Vitnija tests p>0,05) mikrobu bagātībā (mērot ar novērotajiem OTU, 2.A attēls) vai daudzveidībā (novērtēts ar Šenonas daudzveidības indeksu (SDI), 2.B attēls), pamatojoties uz CLABSI statusu. katetra paraugiem. Mēs arī neatradām atšķirības bagātībā un daudzveidībā starp neinficētām un inficētām grupām ādas uztriepēs un asins paraugos. Līdzīgi rezultāti tika iegūti ar datu kopu, kas nav reta (S3 attēls).

(A) Novērotie OTU un (B) Šenonas daudzveidības indeksi ir parādīti izkliedes diagrammās. Alfa daudzveidības metrika neatšķīrās starp inficētiem un neinficētiem katetriem.

Inficēto (CLABSI) un neinficēto jaundzimušo paraugu beta daudzveidība

Beta daudzveidības daudzfaktoru analīzes, ko mēra ar UniFrac attāluma matricām, ir parādītas galvenās koordinātu analīzes (PCoA) diagrammās (3A–3F attēls). Mēs nenovērojām būtisku klasterizāciju pēc infekcijas statusa nevienam no paraugu veidiem, izmantojot nesvērtas UniFrac attāluma matricas (3A–3C attēls) (neinficētās un inficētās grupas: PERMANOVA p>0,05 visiem paraugu veidiem). Līdzīgi rezultāti tika iegūti ar svērtajiem UniFrac attālumiem (3D–3F attēls). Tomēr inficēto subjektu asins mikrobiomi sagrupējās atsevišķi no neinficētiem subjektiem (sk. 3.C attēlu).

Mikrobu kopienu PCoA diagrammas inficētajos (sarkanie apļi) un neinficētajos paraugos (zili apļi) no (A) katetra bioplēves, (B) ādas tamponu un (C) asinis, attiecīgi mērot, izmantojot nesvērtos UniFrac attālumus. Neinficēti asins paraugi tiek grupēti atsevišķi no inficētajiem asins paraugiem (sk. 3.C attēlu), taču katetra bioplēves vai ādas uztriepju mikrobu kopienās nav konstatēta klasterizācija. zīm D-F attēlo svērto UniFrac attāluma metrikas izkliedes diagrammas katetram, ādas tamponam un asins mikrobiomām neinficētās un inficētās grupās. Katrs aplis apzīmē visu bioloģiskā parauga mikrobu kopienu. Pirmie 2 galvenie komponenti (PC1 un PC2) kopā ar izskaidroto izmaiņu apjomu ir parādīti attēlos.

Mikrobu sastāvs un struktūra

Mikrobiomu sastāvs pēc parauga veida.

Mikrobu kopienas sastāvs atšķīrās atkarībā no parauga veida. Pamatojoties uz parauga veidu, mēs konstatējām lielāku Firmicutes patversmes relatīvo pārpilnību gan katetra bioplēvē (BH koriģētā Danna Kruskala-Volisa testā p = 0,03), gan ādas uztriepēs (p = 0,02), salīdzinot ar pārpilnību asinīs (S4 attēls). . Viena no lielākajām CLABSI baktērijām Stafilokoks spp. tika konstatēts ievērojami lielāks daudzums katetros (vidējais relatīvais daudzums = 63%) un ādas uztriepes (59%) nekā asins (16%) paraugos (p<0,05 abiem salīdzinājumiem, S4 un S5 att.). Turklāt vidējā pārpilnība Streptokoks bija ievērojami augstāks katetros (6%), salīdzinot ar vidējo daudzumu ādas uztriepēs (0,01%) (p = 0,0001). Citas ģintis, kas pieder pie Firmicutes, piemēram, Enterokoku un Anaerococcus bija tikai katetra bioplēves paraugos (skatīt S4 un S5 attēlus).

CLABSI un ne-CLABSI jaundzimušo katetra mikrobiomi.

Mēs neatradām statistiski nozīmīgas atšķirības baktēriju fila relatīvajā daudzumā starp inficētiem un neinficētiem katetriem (Mann-Whitney tests p>0,05, 4.A attēls). Tomēr baktēriju grupai ģints līmenī būtiski atšķiras to relatīvais daudzums starp inficētiem un neinficētiem katetriem (p<0,05, sīkāku informāciju skatīt S3 tabulā un 4.B attēlā). Starp ģintīm, kuru vidējais relatīvais daudzums visā grupā ir ≥1%, mēs atklājām ievērojami zemāku Bradirizobijs (p = 0,001) un Cloacibacterium (p = 0,005) inficētajos katetros, salīdzinot ar neinficētiem katetriem (attiecīgi 4.C un 4.D attēls). Turpretim relatīvā pārpilnība Proteus bija ievērojami augstāks (p = 0,01) inficētajos katetros nekā neinficētajos katetros (4.F attēls). Taksoniem ar <1% relatīvā daudzuma Staphylococcaceae_unclassified (piešķirts vienam OTU-337) inficētajos katetros bija lielāks (p = 0,034) salīdzinājumā ar neinficētajiem katetriem (4G attēls), cita starpā (S3 tabula). .

Stieņu diagrammas, kas attēlo katetra bioplēves mikrobiotas taksonomisko sastāvu pie (A) patvērums un (B) ģints līmenis neinficētiem (n = 12) un inficētiem (n = 15) katetriem. Taksoni ar vidējo relatīvo daudzumu <1% ir sagrupēti kopā. Inficēto un neinficēto grupu salīdzināšanai tika izmantots Mann-Whitney tests. Bija ievērojami (p<0,05) mazāks daudzums Bradirizobijs, Cloacibacterium, un Sphingomonas inficētos katetros, salīdzinot ar neinficētiem katetriem (C-E). Turpretim inficētajiem katetra paraugiem bija lielāka (F) Proteus un (G) neklasificēti Staphylococcaceae, salīdzinot ar neinficētiem katetriem.

Stafilokoks, dominējošās baktērijas ādas paraugos, tika konstatēts ar relatīvo pārpilnību vairāk nekā 50% gan inficētos, gan neinficētos katetra mikrobiomos.

Ādas tamponu mikrobiomi CLABSI un ne-CLABSI jaundzimušajiem.

CLABSI jaundzimušo ādas uztriepju mikrobiomi būtiski neatšķīrās no indivīdiem, kas nav CLABSI (Mann-Whitney tests p>0,05) gan patversmes, gan ģints līmenī (5.A un 5.B attēls), izņemot ļoti reti sastopamu ģimeni. līmeņa taksoni- neklasificēti Oxalobacteraceae.

Kolonnas attēlo baktēriju taksonu vidējo relatīvo daudzumu (A) patvērums un (B) ģints līmenis neinficētām (n = 5) un inficētām (n = 6) ādas uztriepēm, kas savāktas attiecīgi no jaundzimušajiem, kas nav CLABSI un CLABSI. Joslu diagrammas, kas parāda baktēriju relatīvo daudzumu atsevišķos asins paraugos, kas savākti no (C) asins kultūra negatīva (nav CLABSI) un (D) asins kultūras pozitīvi (CLABSI) jaundzimušie (identificēti uz x ass). Asins mikrobiomu rezultāti netiek apvienoti neinficētām un inficētām grupām, jo ​​katrs indivīds grupā ir ļoti atšķirīgs asins mikrobiomu sastāva ziņā.

Mikrobiomi CLABSI un ne-CLABSI jaundzimušo asins paraugos.

No sešiem asins paraugiem (kas savākti no sešām dažādām personām), kas iekļauti galīgajā asins mikrobiomu analīzē, trīs paraugi (013B, 051B un 056B) bija “kultūras negatīvi” ar tradicionālām asins kultivēšanas metodēm un tika ziņots kā neinficēti (ti, neinficēti). CLABSI). Tomēr šo ne-CLABSI asins paraugu 16SV4 rRNS sekvencēšana atklāja daudzu baktēriju taksonu klātbūtni, tostarp Bacteroides, Clostridiales, Helicobacter, un neklasificētas Enterobacteriaceae (5.C attēls). No otras puses, “kultūras pozitīvo” asins paraugu (n = 3) 16S sekvencēšana atklāja visas baktēriju ģintis, kas identificētas ar tradicionālām uz kultūru balstītām metodēm (5. D attēls).

Katetru mikrobiomi pēc uztura veida.

Salīdzinot divas dominējošās TPN un enterālās barības uztura grupas (MEBM un DEBM kopā), mēs atklājām vairākus baktēriju taksonus ar ievērojami atšķirīgu relatīvo daudzumu (Mann-Whitney tests p<0, 05) katetra mikrobiomās starp grupām (S4 tabula). Tomēr gan alfa, gan beta katetra mikrobiomu daudzveidība starp grupām neatšķīrās (Šenona indeksa Manna-Vitnija tests p>0,05, nesvērtais UniFrac PERMANOVA p> 0,05).


Infekcijas kontrole

Ņemot vērā vajadzību pēc bieži vien plaša un cieša kontakta starp pacientiem un veselības aprūpes darbiniekiem, pacientiem, kuri saņem veselības aprūpi, un veselības aprūpes darbiniekiem, kuri ir pakļauti SARS-CoV-2 iedarbībai, kas garantē attiecīgi 1. karantīnu vai darba ierobežojumus, joprojām tiek ieteikts 14 dienu karantīnas periods. Šī opcija maksimāli samazina pēckarantīnas pārnešanas risku un ir stratēģija ar šobrīd vislielāko kolektīvo pieredzi.

Alternatīvas 14 dienu karantīnas periodam ir aprakstītas sadaļā Iespējas, kā samazināt karantīnu kontaktpersonām ar SARS-CoV-2 infekciju, izmantojot simptomu uzraudzību un diagnostikas testus. Veselības aprūpes iestādes varētu apsvērt šīs alternatīvas kā līdzekli, lai mazinātu personāla trūkumu, telpu ierobežojumus vai IAL piegādes trūkumu, taču veselības aprūpes iestāžu īpašā rakstura dēļ (piemēram, pacienti, kuriem draud sliktāki rezultāti, veselības aprūpes personāla kritiskais raksturs, sociālās problēmas distancēšana), nevis kā vēlamā iespēja.

Veselības aprūpes iestādēm jāsaprot, ka darba ierobežojuma vai pacientu karantīnas ilguma saīsināšana var radīt papildu transmisijas risku. Viņiem arī jākonsultē pacienti un veselības aprūpes personāls par nepieciešamību uzraudzīt un nekavējoties pašizolēties, ja simptomi parādās 14 dienu laikā pēc saskares ar viņiem, un par to, cik svarīgi ir ievērot visas ieteiktās nefarmaceitiskās iejaukšanās.

1 Veselības aprūpes iestādēs pacienti, kas atrodas karantīnā, parasti tiek izolēti vienas personas istabā, un tos aprūpē veselības aprūpes personāls, izmantojot visus IAL, kas ieteikti pacientiem ar aizdomām vai apstiprinātu SARS-CoV-2 infekciju. Tomēr šos pacientus nedrīkst pieskaitīt pacientiem ar SARS-CoV-2 infekciju, ja vien pārbaudēs nav apstiprināta arī SARS-CoV-2 infekcija.

CDC pašlaik iesaka, ka asimptomātiskiem pacientiem un iedzīvotājiem, kuri ir atveseļojušies un ir 3 mēnešu laikā pēc pozitīva SARS-CoV-2 infekcijas testa, var nebūt nepieciešams ievietot karantīnu vai veikt testus pēc atkārtotas saskares ar SARS-CoV-2. Tomēr var būt klīniski scenāriji, kuros pastāv pārliecība par iepriekšēju infekciju vai imūnreakcijas noturību, kuru gadījumā pakalpojumu sniedzēji varētu apsvērt SARS-CoV-2 testu un ieteikt karantīnu pēc saskares, kas notiek mazāk nekā 3 mēnešus pēc inficēšanās. sākotnējā infekcija. Piemēri var ietvert:

  • Pacienti vai iedzīvotāji, kuriem ir imūnsistēmas traucējumi (piemēram, pacients pēc orgānu transplantācijas) vai kuriem 3 mēnešu laikā pēc SARS-CoV-2 infekcijas kļūst traucēta imūnsistēma (piemēram, viņi saņem ķīmijterapiju) un kuriem varētu būt paaugstināts atkārtotas inficēšanās risks. Tomēr dati par to, kuri īpaši apstākļi var izraisīt lielāku risku, un riska lielums nav pieejami.
  • Pacienti vai iedzīvotāji, kuriem ir bažas, ka viņu sākotnējā SARS-CoV-2 infekcijas diagnoze varētu būt balstīta uz viltus pozitīvu testa rezultātu (piemēram, iedzīvotājs bija asimptomātisks, antigēna tests bija pozitīvs un apstiprinošs nukleīnskābes amplifikācijas tests (NAAT)) netika veikts).
  • Pacienti vai iedzīvotāji, par kuriem ir pierādījumi, ka viņi ir bijuši pakļauti jaunam SARS-CoV-2 variantam (piem., saskarē ar personu, kura ir inficēta ar jaunu variantu), kuriem atkārtotas inficēšanās risks varētu būt lielāks

CDC turpina aktīvi izmeklēt atkārtotas inficēšanās biežumu un apstākļus, kas saistīti ar šīm epizodēm, tostarp jauno variantu lomu atkārtotā inficēšanā, un vajadzības gadījumā pielāgos norādījumus, tiklīdz būs pieejama vairāk informācijas.

Jā. Lai pacienti un veselības aprūpes personāls (HCP) būtu veseli un droši, CDC un rsquos infekciju profilakses un kontroles norādījumi attiecas uz visiem iestatījumiem, kur tiek sniegta veselības aprūpe. Tomēr, tāpat kā jebkuras norādes, iekārtas var pielāgot noteiktus ieteikumus saviem iestatījumiem. Piemēram, stacionārā psihiatriskā aprūpe ietver kopīgu pieredzi un grupu aktivitātes, kuras var būt jāturpina. Ja tā, iespējams, šīs aktivitātes būs jāpielāgo, lai tās atbilstu sociālās distancēšanās ieteikumiem. Citi ieteicamie infekciju kontroles pasākumi (piemēram, piekļuves nodrošināšana roku dezinfekcijas līdzeklim uz alkohola bāzes, pacientu ar Covid-19 sagrupēšana un specializēta personāla norīkošana vai universālu avotu kontroles pasākumu ieviešana) var nebūt droši vai piemēroti īstenošanai visās vietās vai visiem. pacientiem drošības un uzvedības apsvērumu dēļ.

Izaicinājumi un iespējamie risinājumi, kas raksturīgi uzvedības veselības iestatījumiem, var ietvert:

  • Kohortēšana
    • Izaicinājums: Lai novērstu pārnešanu, pacientus ar Covid-19 parasti ieteicams pārvietot uz atsevišķu iestādes zonu, kur viņus var aprūpēt specializēts HCP. Drošības apsvērumu vai specializētu aprūpes vajadzību dēļ var nebūt iespējams apvienot noteiktus pacientus vai mainīt viņu aprūpei piešķirto HCP.
    • Potenciālie risinājumi: Ja kohortēšana nav iespējama, veiciet pasākumus, lai saglabātu sociālo distancēšanos (vismaz 6 pēdas) starp pacientiem ar Covid-19 un citiem nodaļas darbiniekiem. Ideālā gadījumā tas ietvertu atsevišķu vannas istabu COVID-19 pacientiem. Rūpējoties par pacientiem ar aizdomām vai apstiprinātu Covid-19, HCP lieto visus ieteiktos individuālos aizsardzības līdzekļus (IAL).
    • Izaicinājums: grupu konsultācijas, terapija un diskusiju sesijas ir būtiska psihiatriskās ārstēšanas un aprūpes plānu sastāvdaļa, taču tradicionālā šo aktivitāšu sistēma nav savienojama ar sociālās distancēšanās ieteikumiem.
    • Potenciālie risinājumi: Ja iespējams, izmantojiet virtuālās metodes vai samaziniet grupas lielumu, lai varētu saglabāt sociālo distancēšanos. Gadījumā, ja Covid-19 tiek pārnēsāts iestādē, sesijas jāpārtrauc vai jāpāriet uz video diskusiju forumu, līdz tiek ieviesti papildu infekcijas profilakses pasākumi, lai apturētu izplatību.
    • Izaicinājums: Dažiem pacientiem auduma sejas pārklājumu vai sejas masku lietošana var radīt papildu briesmas vai izraisīt diskomfortu. Daži pacienti var nespēt vai nevēlēties tos lietot, kā paredzēts. Elastīgās un auduma siksnas var izmantot sevis vai citu žņaugšanai, bet metāla deguna tiltiņus var izmantot paškaitējumam vai kā ieroci.
    • Potenciālie risinājumi: Apsveriet iespēju ļaut pacientiem ar zemu nepareizas lietošanas risku valkāt auduma sejas pārsegus vai sejas maskas, dodot priekšroku tiem, kuriem ir īsās ausu cilpiņas, nevis garākas saites. Apsveriet iespēju izmantot auduma sejas pārsegus vai sejas maskas uzraudzītu grupu aktivitāšu laikā. Nodrošiniet, lai HCP, kas mijiedarbojas ar pacientiem, kuri nevar valkāt auduma sejas aizsegu vai sejas masku, valkā acu aizsargus un sejas masku (vai respiratoru, ja ir aizdomas, ka pacientam ir COVID-19, un ir pieejami respiratori).
    • Izaicinājums: Lai gan spirtu saturošs roku dezinfekcijas līdzeklis (ABHS), kas satur 60–95% spirta, ir svarīgs līdzeklis, lai palielinātu roku higiēnas ieteikumu ievērošanu, ABHS ir rūpīgi jāizmanto psihiatriskajās iestādēs, lai nodrošinātu, ka pacienti to neuzņem.
    • Potenciālie risinājumi: Apsveriet iespēju neizvietot ABHS pacientu un psihiatrisko iestāžu telpās, kā arī vietās, kur pacientiem ir bez uzraudzības. Mudiniet pacientus un HCP bieži mazgāt rokas ar ziepēm un ūdeni. Apsveriet iespēju nodrošināt personiskus, kabatas formāta ABHS dozatorus HCP.
    • Izaicinājums: kā daļa no sociālās distancēšanās, koplietošanas maltītes parasti nav ieteicamas. Tomēr ēšana ir jāuzrauga, jo ar ēšanas piederumiem var tikt nodarīts kaitējums un bieži lietotas psihiatriskās zāles var izraisīt blakusparādības (piemēram, tardīvo diskinēziju, disfāgiju, hipo- un hipersiekalošanos), kas palielina aizrīšanās risku pacientiem.
    • Potenciālie risinājumi: Viena iespēja ir novietot personālu pacientu un ārstniecības iestādēs, lai uzraudzītu viņu ēdināšanu. Vēl viena iespēja ir atļaut kopīgu ēdināšanu maiņās, lai darbinieki varētu uzraudzīt pacientus, vienlaikus nodrošinot, ka viņi atrodas vismaz 6 pēdu attālumā viens no otra. Trešā iespēja ir likt pacientiem sēdēt atbilstoši izvietotos krēslos gaitenī ārpus viņu istabām, lai viņus varētu uzraudzīt, kamēr viņi ēd.
    • Izaicinājums: Lielāks psihiatrisko pacientu īpatsvars smēķē cigaretes, salīdzinot ar vispārējo populāciju. Pacienti var pulcēties āra smēķēšanas vietās, nepraktizējot atbilstošu sociālo distancēšanos.
    • Potenciālie risinājumi: Ierobežojiet pacientu skaitu, kuriem vienlaikus ir atļauts piekļūt smēķēšanas vietām, un novietojiet personālu tā, lai viņi novērotu un nodrošinātu, ka pacienti ievēro atbilstošu fizisko distancēšanos.

    Iekārtām jāievēro to valsts vai jurisdikcijas ziņošanas prasības. Tiem, ko regulē Medicare un Medicaid pakalpojumu centri (CMS) (piemēram, pansionāti), arī jāievēro visas CMS prasības ārējā ikona , kas tiek atjaunināta, iekļaujot jaunas prasības ziņošanai CDC un iedzīvotājiem un viņu pārstāvjiem.

    Turklāt CDC iesaka nekavējoties informēt veselības departamentus par:

    • Iedzīvotāji vai veselības aprūpes darbinieki (HCP), kuriem ir aizdomas vai apstiprināts Covid-19,
    • Iedzīvotāji ar smagu elpceļu infekciju, kas izraisījusi hospitalizāciju vai nāvi, un
    • &ge 3 rezidenti vai HCP ar jauniem elpceļu simptomiem 72 stundu laikā viens pēc otra.

    Tie var liecināt par COVID-19 vai citas elpceļu slimības uzliesmojumu iestādē. Veselības departaments var sniegt svarīgus norādījumus, lai palīdzētu atrast gadījumu un apturēt pārnešanu.

    Iestādē jābūt arī plānam un mehānismam, lai regulāri sazinātos ar iedzīvotājiem, ģimenes locekļiem un HCP, tostarp, ja iestādē tiek konstatēti Covid-19 gadījumi. Bieži vien informācija pansionātos tiek nodota rātsnama sanāksmēs un personāla sanāksmēs, kā arī vēstulēm vai e-pastiem. Tomēr COVID-19 pandēmijas laikā klātienē pulcēties nevajadzētu. Tā vietā saziņai ir jānotiek virtuālās sanāksmēs pa tālruni vai tīmekļa platformām. Tie būtu jāpapildina ar rakstiskiem paziņojumiem, kas sniedz kontaktinformāciju personālam, kurš var atbildēt uz jautājumiem vai bažām. Komunikācijā jāiekļauj informācija, kas apraksta pašreizējo situāciju, plāni izplatības ierobežošanai objektā un ieteicamās darbības, ko viņi var veikt, lai aizsargātu sevi un citus. Iestādēm šī informācija būtu jādara pieejama savlaicīgi un jāpiedāvā periodiski atjauninājumi, kad situācija attīstās un kļūst pieejama vairāk informācijas.

    Nē. Pacientiem, kas hospitalizēti ar SARS-CoV-2 infekciju, lēmumi par izrakstīšanu no slimnīcas jāpieņem, pamatojoties uz viņu klīnisko stāvokli un uzņemošās iestādes spēju apmierināt viņu aprūpes vajadzības un ievērot ieteikto infekciju profilakses un kontroles praksi. Lēmumi par slimnīcas izrakstīšanu atšķiras no lēmumiem par transmisijas piesardzības pasākumu pārtraukšanu.

    Pacientiem ar aizdomām vai apstiprinātu SARS-CoV-2 infekciju lēmumiem par pārnešanas izraisītu piesardzības pasākumu pārtraukšanu ir jābūt balstītiem uz šeit izklāstītajām stratēģijām. Uz testiem balstīta stratēģija ir ieteicama lietošanai tikai ierobežotos apstākļos.

    Ja pacientam ir aizdomas vai apstiprināta SARS-CoV-2 infekcija nav atbilst kritērijiem, lai pārtrauktu uz transmisiju balstītu piesardzību, tie ir jānodod uz iestādi, kas spēj ievērot infekciju profilakses un kontroles ieteikumus, lai aprūpētu iedzīvotājus ar SARS-CoV-2 infekciju, ieskaitot ievietošanu iestādes nodaļā vai teritorijā. paredzēta iedzīvotāju ar SARS-CoV-2 infekciju aprūpei un ieteicamo individuālo aizsardzības līdzekļu nodrošināšanai veselības aprūpes darbiniekiem.

    Ja pacients ir atbilda uz pārraidi balstītu piesardzības pasākumu pārtraukšanas kritērijiem, tiem nav nepieciešami papildu ierobežojumi.

    Pacientu, kas hospitalizēts ar COVID nesaistītu slimību dēļ, kuram nav zināma SARS-CoV-2 infekcija, var pārvietot uz pansionātu bez pārbaudes. Lai nodrošinātu, ka pacients nav pakļauts iedarbībai un pēc tam viņam var attīstīties SARS-CoV-2 infekcija, pansionātos pacients 14 dienas pēc uzņemšanas jānovieto uz transmisiju balstītu piesardzības pasākumu nodaļā atsevišķā novērošanas zonā vai vienas personas telpā.

    Universālo avotu kontroles pasākumu ietvaros visiem iedzīvotājiem (tostarp tiem, kas aprakstīti iepriekš minētajos scenārijos) ikreiz, kad viņi atstāj savu istabu, jāvalkā auduma sejas pārklājums vai sejas maska ​​(ja pieļaujams).

    Kā daļu no ikdienas prakses veselības aprūpes personālam (HCP) ir jāievēro standarta piesardzības pasākumi. HCP vienmēr apzināti jānovērtē iespējamie riski, kas saistīti ar saskarsmi ar infekciozu materiālu, pirms uzsākt darbības un procedūras veselības aprūpes sniegšanas jomā. Pamatojoties uz riska novērtējumu, aprūpes punktā ir jāievieš droša darba prakse, tostarp inženiertehniskie kontroles pasākumi, kas samazina infekciozu materiālu izdalīšanos, administratīvā kontrole un individuālo aizsardzības līdzekļu (IAL) lietošana saskaņā ar CDC vadlīnijām un prakses standartiem. veikto darbību.

    Lai samazinātu SARS-CoV-2 iedarbību COVID-19 pandēmijas laikā, CDC iesaka iestādēm:

    • ja iespējams, apsveriet neoperatīvas pieejas
    • pēc iespējas samazināt tādu procedūru vai paņēmienu izmantošanu, kas var radīt infekciozus aerosolus
    • līdz minimumam samaziniet cilvēku skaitu operāciju vai procedūru telpā, lai samazinātu iedarbību
    • izmantot kopienas pārnešanas apjomu un novērtējumu par pacienta kaitējuma iespējamību, ja aprūpe tiek aizkavēta, lai pieņemtu lēmumus par plānveida operāciju un procedūru atcelšanu vai atlikšanu un
    • īstenot universālus avota kontroles pasākumus, kas ietver pacientu uzlikšanu auduma sejas pārklājumam (kā pieļaujams) un HCP visu laiku, kamēr viņi atrodas veselības aprūpes iestādē, valkāt sejas masku.

    Ja operāciju vai procedūras nevar atlikt, HCP, kas aprūpē pacientus ar aizdomām vai apstiprinātu Covid-19, ir jāievēro visa ieteicamā Covid-19 infekciju profilakses un kontroles prakse. Tas iekļauj:

    • Izmantojot visus ieteiktos IAL: N95 vai līdzvērtīgu vai augstāka līmeņa respiratoru (vai sejas masku, ja respiratori nav pieejami), acu aizsargus, cimdus un halātu.
      • Ķirurģisku procedūru laikā nedrīkst lietot respiratorus ar izelpas vārstiem, jo ​​nefiltrēta izelpota elpa var apdraudēt sterilo lauku.
      • Ja pastāv deficīts, N95 vai līdzvērtīgi vai augstāka līmeņa respiratori ir jānosaka par prioritāti procedūrām, kas saistītas ar augstāka riska metodēm (piemēram, kas rada potenciāli infekciozus aerosolus) vai anatomiskos apgabalus, kur vīrusu slodze varētu būt lielāka (piemēram, deguns un kakls, mutes un rīkles, elpceļi).

      Tā kā SARS-CoV-2 var pārnēsāt personas, kuras ir inficētas, bet kurām nav simptomu, dažas inficētās personas netiks identificētas, pārbaudot klīniskās pazīmes un simptomus. HCP, sniedzot ķirurģisku vai procedūru aprūpi pacientiem, kuriem nav aizdomas par SARS-CoV-2 infekciju, jāizmanto daudzpakāpju pieeja, pamatojoties uz pārnešanas līmeni sabiedrībā, lai informētu par nepieciešamību pēc vispārējas acu aizsardzības un respiratora lietošanas. HCP jāturpina lietot acu aizsargus vai N95 vai līdzvērtīgu vai augstāka līmeņa respiratoru, ja tas ir ieteikts pacientu aprūpei kā daļa no standarta vai uz transmisiju balstītiem piesardzības pasākumiem.

      Papildus universālo IAL izmantošanai un avotu kontrolei veselības aprūpes iestādēs var izmantot mērķtiecīgu SARS-CoV-2 testēšanu pacientiem bez Covid-19 pazīmēm vai simptomiem, lai identificētu pacientus ar asimptomātisku vai pirmssimptomātisku SARS-CoV-2 infekciju. un vēl vairāk samazinātu iedarbības risku dažās veselības aprūpes iestādēs. Atkarībā no vietējo un valsts veselības departamentu norādījumiem, testēšanas pieejamības un to, cik ātri ir pieejami rezultāti, iestādes var apsvērt iespēju veikt pirmsieņemšanas vai pirmsprocedūras diagnostisko testēšanu ar atļautiem nukleīnskābju vai antigēnu noteikšanas testiem SARS-CoV-2.
      Pārbaudes rezultāti var palīdzēt pieņemt lēmumus par plānoto procedūru pārplānošanu vai par nepieciešamību pēc papildu piesardzības pasākumiem, kas balstīti uz transmisiju, aprūpējot pacientu. Šīs testēšanas stratēģijas izmantošanas ierobežojumi ietver negatīvu rezultātu iegūšanu pacientiem inkubācijas periodā, kuri vēlāk kļūst infekciozi, un viltus negatīvus testa rezultātus atkarībā no izmantotās testa metodes.

      CDC&rsquos norādījumi par NIOSH apstiprināta N95 vienreizējās filtrēšanas sejas vai augstāka līmeņa respiratoru lietošanu, sniedzot aprūpi pacientiem ar aizdomām vai zināmu Covid-19, ir balstīti uz pašreizējo izpratni par SARS-CoV-2 un saistītajiem elpceļu vīrusiem.

      Pašreizējie dati liecina, ka iespējamie pārnešanas ceļi ir aerosola pārnešana tuva diapazonā ar pilienu un ieelpošanu, kā arī kontakts, kam seko pašpiegāde acīs, degunā vai mutē. Liela attāluma aerosola pārnešana, piemēram, masalām, nav bijusi SARS-CoV-2 iezīme.

      Iespējamie pārnešanas ceļi tuvu diapazonā ietver infekcioza materiāla izšļakstīšanu un izsmidzināšanu uz gļotādām un infekciozu virionu ieelpošanu, ko izelpojusi inficēta persona. Katra no tām relatīvais ieguldījums SARS-Co-V-2 gadījumā nav zināms.

      Sejas maskas, ko parasti izmanto ķirurģisko procedūru laikā, nodrošinās barjeru aizsardzību pret pilieniem, kas nonāk saskarē ar deguna un mutes gļotādām, taču tās nav paredzētas, lai aizsargātu lietotājus no sīku daļiņu ieelpošanas. N95 un augstāka līmeņa respiratori, piemēram, citi vienreizējās lietošanas respiratori ar filtrēšanu, gaisa attīrīšanas respiratori (PAPR) un elastomēra respiratori nodrošina gan barjeru, gan elpceļu aizsardzību, jo tie ir cieši pieguļoši un filtrēti.

      Respiratori ir jāizmanto kā daļa no elpceļu aizsardzības programmas, kas nodrošina personālam medicīnisku novērtējumu, apmācību un piemērotības pārbaudi.

      Lai gan sejas maskas parasti tiek izmantotas, lai aprūpētu pacientus ar parastām vīrusu elpceļu infekcijām, N95 vai augstāka līmeņa respiratorus regulāri iesaka jauniem patogēniem, piemēram, SARS CoV-2, kas var pārnēsāt ar mazām daļiņām, kas spēj izraisīt smagas infekcijas, un nekādas īpašas ārstēšanas vai vakcīnas.

      CDC ieteikumos ir atzītas pašreizējās problēmas ar ierobežotām N95 un citu respiratoru piegādēm. Iestādēs, kurās nav pietiekami daudz N95 un citu respiratoru visai pacientu aprūpei, par prioritāti ir jānosaka to izmantošana darbībām un procedūrām, kas rada lielu infekciozu aerosolu rašanās risku, un jāizmanto sejas maskas aprūpei, kas neietver šīs darbības vai procedūras. Sīki izstrādātas stratēģijas N95 respiratoru piegādes optimizēšanai ir pieejamas CDC vietnē. Kad krājumu pieejamība ir atjaunota, vadlīnijās ir teikts, ka ir jāatsāk N95 un augstāka līmeņa respiratoru lietošana.

      Kopumā pacientu ar aizdomām vai apstiprinātu SARS-CoV-2 infekciju pārvadāšana un pārvietošana ārpus savas istabas būtu jāierobežo ar medicīniski būtiskiem mērķiem. Ja tiek transportēts ārpus telpas, piemēram, uz radioloģiju, veselības aprūpes personāls (HCP) saņemšanas zonā ir jābrīdina pirms pacienta transportēšanas. Transportēšanas laikā pacientam jāvalkā sejas maska ​​vai auduma sejas pārklājums (ja pieļaujams), lai nesatur sekrēcijas, un ir jāpārklāj ar tīru palagu.

      Ja transportēšanas personālam ir jāsagatavo pacients transportēšanai (piem., jāpārvieto viņš ratiņkrēslā vai gurnā), transporta personālam ir jāvalkā visi ieteicamie IAL (cimdi, halāts, elpceļu aizsarglīdzekļi, kas ir vismaz tikpat aizsargājoši kā piemēroti, pārbaudīti NIOSH sertificēti vienreizējie izstrādājumi). N95 filtrējošs sejas respirators vai sejas maska, ja respirators nav pieejams, un acu aizsargi [ti, aizsargbrilles vai vienreizējās lietošanas sejas vairogs, kas nosedz sejas priekšpusi un sānus]). Šis ieteikums ir nepieciešams, jo šī mijiedarbība parasti ietver ciešu, bieži vien klātienes kontaktu ar pacientu slēgtā telpā (piemēram, pacientu telpā). Kad pacients ir pārvietots uz ratiņkrēslu vai gurnu (un pirms iziešanas no telpas), pārvadātājiem jānovelk halāts un cimdi un jāveic roku higiēna.

      Transportētājam jāturpina valkāt respiratoru vai sejas masku. Transportētājam ir ieteicams arī turpmāk lietot acu aizsargus, ja pastāv iespēja, ka pacients transportēšanas laikā nevarēs panest savu sejas masku vai auduma sejas aizsegu. Papildu IAL nevajadzētu prasīt, ja vien nav paredzama nepieciešamība sniegt medicīnisko palīdzību transportēšanas laikā (piemēram, palīdzēt pacientam nomainīt nobīdītu sejas masku).

      Pēc ierašanās galamērķī saņēmējam personālam (piemēram, radioloģijā) un pārvadātājam (ja palīdz pārvietot) ir jāveic roku higiēna un jāvalkā visi ieteicamie IAL. Ja pārvadātājam joprojām tiek nēsāts oriģinālais respirators vai sejas maska ​​un acu aizsargi, tad, uzvelkot atlikušos ieteiktos IAL, pārvadātājam ir jārūpējas, lai izvairītos no pašpiesārņošanas. Šī piesardzīgā pieeja tiks pilnveidota un atjaunināta, tiklīdz būs pieejama plašāka informācija un mainoties reaģēšanas vajadzībām Amerikas Savienotajās Valstīs.

      Pagaidu norādījumi NMP personālam, kas pārvadā pacientus ar apstiprinātu vai aizdomām par SARS-CoV-2 infekciju, ir pieejami šeit. NMP personālam jāvalkā visi ieteicamie IAL, jo viņi sniedz tiešu medicīnisko aprūpi un ilgstoši atrodas ciešā kontaktā ar pacientu.

      Parasti SARS-CoV-2 infekciju pacientu istabā drīkst iekļūt tikai nepieciešamais personāls. Veselības aprūpes iestādēm būtu jāapsver iespēja ikdienas tīrīšanu un dezinficēšanu paaugstinātas pieskāriena virsmās uzticēt aprūpes personālam, kurš jau atradīsies telpā, kas nodrošina pacienta aprūpi. Ja šī atbildība ir uzticēta EBD personālam, viņiem, atrodoties telpā, jāvalkā visi ieteicamie IAL. IAL ir jānoņem, izejot no telpas, un tūlīt pēc tam jāveic roku higiēna.

      Pēc izlādes termināļa tīrīšanu var veikt EVS personāls. Viņiem jāatliek iekļūšana telpā, līdz ir pagājis laiks, lai pietiekami daudz gaisa mainītu, lai noņemtu potenciāli infekciozās daļiņas. Kad šis laiks ir pagājis, EBD darbinieki var iekļūt telpā, un, veicot termināļa tīrīšanu, viņiem ir jāvalkā sejas maska ​​(avota kontrolei), kā arī halāts un cimdi. Ja, pamatojoties uz izvēlētajiem tīrīšanas līdzekļiem, tīrīšanas un dezinfekcijas darbību laikā ir sagaidāmi vai citādi nepieciešami šļakatas, ir jāpievieno acu aizsardzība. Apavu pārvalki pašlaik nav ieteicami personālam, kas aprūpē pacientus ar SARS-CoV-2 infekciju.

      Dažas procedūras, kas tiek veiktas pacientiem, visticamāk, rada lielāku infekciozo elpceļu aerosolu koncentrāciju nekā klepojot, šķaudot, runājot vai elpojot. Šīs aerosola ģenerēšanas procedūras (AGP) potenciāli pakļauj veselības aprūpes personālam un citiem cilvēkiem paaugstinātu patogēnu iedarbības un infekcijas risku.

      Visaptveroša AGP saraksta izveide veselības aprūpes iestādēm nav bijusi iespējama, jo ir ierobežoti pieejamie dati par to, kuras procedūras var radīt potenciāli infekciozus aerosolus, un problēmas, kas rodas, nosakot, vai ziņotā transmisija AGP laikā ir saistīta ar aerosolu vai citu iedarbību.

      Nav ne ekspertu vienprātības, ne pietiekamu apstiprinošu datu, lai izveidotu galīgu un visaptverošu AGP sarakstu veselības aprūpes iestādēm.

      Bieži veiktas medicīniskās procedūras, kuras bieži uzskata par AGP vai kas rada nekontrolētu elpceļu sekrēciju, ietver:

      • atvērta elpceļu atsūkšana
      • krēpu indukcija
      • sirds un plaušu reanimācija
      • endotraheālā intubācija un ekstubācija
      • neinvazīvā ventilācija (piemēram, BiPAP, CPAP)
      • bronhoskopija
      • manuāla ventilācija

      Pamatojoties uz ierobežotiem pieejamajiem datiem, nav skaidrs, vai aerosoli, kas rodas dažu procedūru rezultātā, var būt infekciozi, piemēram:

      *Aerosoli, ko rada smidzinātāji, tiek iegūti no smidzinātājā esošajiem medikamentiem. Nav skaidrs, vai iespējamās saistības starp šīs kopīgās procedūras veikšanu un paaugstinātu infekcijas risku varētu būt saistītas ar procedūras radītajiem aerosoliem vai palielinātu kontaktu starp tiem, kas ievada izsmidzināto medikamentu, un inficētiem pacientiem.

      Atsauces saistībā ar aerosola ģenerēšanas procedūrām:

      Tran K, Cimon K, Severn M, Pessoa-Silva CL, Conly J (2012) Aerosola ģenerēšanas procedūras un akūtu elpceļu infekciju pārnešanas risks veselības aprūpes darbiniekiem: sistemātisks pārskats. PLoS ONE 7(4) https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3338532/#!po=72.2222external iconārēja ikona ārējā ikona ).

      Lai gan tiek uzskatīts, ka SARS-CoV-2 izplatība galvenokārt notiek ar elpceļu pilieniem, pašlaik nav skaidrs, vai mazās ieelpojamās daļiņas ir pārnēsāšanā no tuvas tuvumā. Pārnešana no cilvēka uz cilvēku lielos attālumos ir maz ticama.

      Laiks, cik ilgi gaiss pārbaudes telpā saglabājas potenciāli infekciozs, nav zināms, un tas var būt atkarīgs no vairākiem faktoriem, tostarp telpas lieluma, gaisa izmaiņu skaita stundā, pacienta uzturēšanās ilguma, ja pacients klepoja vai šķaudīja, un, ja tika veikta aerosola ģenerēšanas procedūra. Telpām šie faktori būs jāņem vērā, lemjot, kad atbrīvotajā telpā var iekļūt kāds, kurš nevalkā IAL.

      Pacientam, kurš neklepo vai šķaudīja, nav veicis aerosola ģenerēšanas procedūru un pavadīja telpā īsu laiku (piem., dažas minūtes), jebkurš risks HCP un nākamajiem pacientiem, iespējams, izzūd vienā minūtes. Tomēr pacientam, kurš klepoja un ilgāku laiku uzturējās telpā vai tika veikta aerosola ģenerēšanas procedūra, riska periods, visticamāk, ir ilgāks.

      Šiem augstāka riska scenārijiem ir saprātīgi piemērot līdzīgu laika periodu, kāds tiek izmantots patogēniem, kas izplatās pa gaisu (piemēram, masalām, tuberkulozei), un ierobežot HCP un pacientu bez IAL iekļūšanu telpā, līdz ir pagājis pietiekams laiks pietiekami daudz gaisa maiņas, lai noņemtu potenciāli infekciozās daļiņas.

      Papildus tam, lai nodrošinātu pietiekami daudz laika gaisa maiņai, lai noņemtu potenciāli infekciozās daļiņas, HCP ir jātīra un jādezinficē apkārtējās vides virsmas un koplietošanas aprīkojums, pirms telpu izmanto citam pacientam.

      CDC ir izlaidusi informāciju par stratēģijām, lai optimizētu izolācijas tērpu piegādi. Veselības aprūpes iestādēm ir jāatsaucas uz šiem norādījumiem un jāīsteno ieteiktās stratēģijas, lai optimizētu pašreizējo halātu piegādi. Tas ietver pāreju uz mazgājamu auduma halātu lietošanu, ja iespējams.

      Tērpu lietošana kā daļa no piesardzības pasākumiem saskarsmē saistībā ar MDRO ir ieviesta galvenokārt, lai samazinātu pārnešanas risku citiem pacientiem, nevis lai aizsargātu veselības aprūpes personālu (HCP). Iestādes, kurās trūkst, varētu apsvērt halātu lietošanas pārtraukšanu, lai aprūpētu pacientus ar endēmiskiem MDRO, piemēram, MRSA, VRE un ESBL veidojošiem gramnegatīviem baciļiem, izņemot gadījumus, kas nepieciešami standarta piesardzības pasākumiem. Iestādēm jānovērtē vietējā epidemioloģija, lai noteiktu, kuri MDRO tiek uzskatīti par endēmiskiem. Neatkarīgi no halātu lietošanas HCP iestādēs jāturpina valkāt cimdus, lai saskartos ar šiem pacientiem un viņu vidi. Jāturpina uzsvērt roku higiēnu. Iestādēm arī jāmēģina ievietot pacientus, kuri ir kolonizēti vai inficēti ar MDRO, privātā telpā, ja tāda ir pieejama.

      • Rūpes par pacientiem, kuriem ir ļoti rezistenti gramnegatīvi mikroorganismi (piemēram, pret karbapenēmu rezistenti Enterobacteriacae) un citi MDRO (piemēram,Candida auris), kas netiek uzskatīti par endēmiskiem: Tā vietā, lai uzvilktu halātus katrā telpā, tie ir jārezervē izmantošanai kā daļa no standarta piesardzības pasākumiem, kā arī jāpiešķir prioritāte augsta kontakta pacientu aprūpes darbībām, kas rada vislielāko risku patogēnu pārnešanai no pacienta uz HCP. Šādu augsta kontakta aprūpes darbību piemēri ir ģērbšanās, vannošanās/dušā, pārvietošana, higiēnas nodrošināšana, veļas maiņa, biksīšu maiņa vai palīdzība tualetē, ierīces kopšana vai lietošana (centrālā līnija, urīna katetrs, barošanas caurule, traheostoma/ventilators) un brūču kopšana. Lai vēl vairāk saglabātu halātus, HCP ieteicams apvienot augsta kontakta aprūpes aktivitātes kā daļu no individuālas aprūpes tikšanās. Neatkarīgi no halātu lietošanas HCP iestādēs jāturpina valkāt cimdus, lai saskartos ar šiem pacientiem un viņu vidi. Jāturpina uzsvērt roku higiēnu. Iestādēm arī jāmēģina ievietot pacientus, kuri ir kolonizēti vai inficēti ar MDRO, privātā telpā, ja tāda ir pieejama.
      • Rūpes par pacientiem arClostridioides difficileinfekcijas (CDI): Iestādēm jāturpina lietot piesardzības pasākumus saskarē (ieejot pacienta telpā, uzvilkt halātu un cimdus un ievietot pacientu privātā telpā), lai aprūpētu simptomātiskus pacientus ar CDI. Kā daļu no papildu stratēģijas, lai novērstu CDI pārnešanu, dažās iestādēs ir ieviesti piesardzības pasākumi, lai ārstētu pacientus, kuriem ir augsts CDI risks un kuriem ir asimptomātiska pārnēsāšana. Clostridioides difficile. Ir ierobežoti dati par asimptomātiskas pārvadāšanas lomu CDI pārnešanā. Šādā situācijā, kad valsts mērogā trūkst halātu, iestādēm būtu jāapsver šīs pieejas pārtraukšana, līdz trūkums tiks novērsts. Tērpi joprojām ir jāizmanto kā daļa no standarta piesardzības pasākumiem.

      Ikviens, kuram bija ilgstošs ciešs kontakts (6 pēdu rādiusā kopumā 15 minūtes vai ilgāk 24 stundu periodā) ar inficēto veselības aprūpes sniedzēju, varēja būt pakļauts iedarbībai.

      • Ja pakalpojumu sniedzējam bija Covid-19 simptomi, pakalpojumu sniedzējs tiek uzskatīts par potenciāli infekciozu, sākot 2 dienas pirms pirmo simptomu parādīšanās, līdz pakalpojumu sniedzējs atbilst kritērijiem, lai pārtrauktu uz transmisiju balstītus piesardzības pasākumus vai izolāciju mājās.
      • Ja pakalpojumu sniedzējam nebija simptomu, apkopojot informāciju par to, kad pakalpojumu sniedzējs varēja būt pakļauts iedarbībai, varētu palīdzēt informēt par periodu, kad viņi bija inficēti.
        • Ja tiek konstatēta iedarbība. Pakalpojumu sniedzējs jāuzskata par potenciāli infekciozu, sākot 2 dienas pēc saskares, līdz ir izpildīti kritēriji, lai pārtrauktu uz transmisiju balstītus piesardzības pasākumus vai izolāciju mājās.
        • Ja iedarbības datumu nevar noteikt. Kontaktu izsekošanas nolūkos kā sākumpunktu ir lietderīgi izmantot 2 dienas pirms parauga, kura tests ir pozitīvs attiecībā uz SARS-CoV-2, savākšanas, līdz tiek izpildīti uz transmisiju balstītu piesardzības vai mājas izolācijas pārtraukšanas kritēriji. .Lai gan parasti tiek pieņemts, ka infekcijas periods ir 10 dienas pēc infekcijas sākuma, kontaktu izraisīšana visu 10 dienu laikā pirms parauga iegūšanas, kura tests ir pozitīvs attiecībā uz SARS-CoV-2, visticamāk, ir neefektīvs. Vairumā gadījumu atklātais pakalpojumu sniedzējs nevar atsaukt atmiņā visus kontaktus pēdējo 10 dienu laikā. Turklāt, tā kā jaunākie dati liecina, ka asimptomātiskām personām diagnozes laikā var būt mazāks vīrusu slogs nekā personām, kurām ir simptomi, nepieciešamie papildu resursi var novirzīt lietas izmeklēšanas un kontaktu izsekošanas resursus no darbībām, kas, visticamāk, pārtrauc notiekošo pārnešanu.

        Kontaktu izsekošana parasti ir ieteicama ikvienam, kam šajos laika periodos ir bijis ilgstošs ciešs kontakts ar SARS-CoV-2 infekciju. Lai gan šis jautājums attiecas uz saskarsmi ar potenciāli infekciozu pakalpojumu sniedzēju, ir ieteicamas arī šādas darbības, ja potenciāli inficētā persona ir pacients vai apmeklētājs.

        Ieteicamās darbības HCP, pacientiem un apmeklētājiem:

        • Veiciet riska novērtējumu un piemērojiet darba ierobežojumus citiem HCP, kuri bija pakļauti inficētā pakalpojumu sniedzēja iedarbībai, pamatojoties uz to, vai šiem HCP ir bijis ilgstošs, ciešs kontakts un kādus IAL viņi valkāja. Detalizētāka informācija ir pieejama ASV Pagaidu vadlīnijās par riska novērtēšanu un darba ierobežojumiem veselības aprūpes personālam, kurš ir potenciāli pakļauts Covid-19.
        • Novietojiet iedarbībai pakļautos pacientus, kuri pašlaik ir ievietoti veselības aprūpes iestādē, ievērojot atbilstošus uz transmisiju balstītus piesardzības pasākumus un uzraugiet viņus attiecībā uz SARS-CoV-2 infekcijas sākšanos līdz 14 dienām pēc pēdējās saskares. .
        • Veikt saskarsmes izsekošanu tiem pakļautajiem pacientiem, kuri pašlaik netiek uzņemti veselības aprūpes iestādē, un apmeklētājiem, kā aprakstīts sadaļā Veselības departamenti: Pagaidu norādījumi par Covid-19 gadījuma izmeklēšanas un kontaktu izsekošanas plāna izstrādi.

        Veselības aprūpes iestādēm ir jābūt procesam, lai informētu veselības departamentu par zināmiem vai iespējamiem SARS-CoV-2 infekcijas gadījumiem, un, apspriežoties ar vietējām sabiedrības veselības iestādēm, jāizstrādā plāns, kā tiks izmeklēta iedarbība veselības aprūpes iestādē un kā tiks veikta kontaktu izsekošana. Plānā jāattiecas uz šādiem jautājumiem:

        • Kas ir atbildīgs par kontaktpersonu identificēšanu un potenciāli pakļauto personu informēšanu?
        • Kā notiks šādi paziņojumi?
        • Kādas darbības un turpmākie pasākumi ir ieteicami tiem, kuri tika pakļauti iedarbībai?

        Kontaktpersonu izsekošana jāveic tā, lai pēc iespējas aizsargātu skarto personu konfidencialitāti un būtu saskaņā ar piemērojamiem tiesību aktiem un noteikumiem. Paziņošanai par prioritāti būtu jānosaka HCP un pacienti, kuri pašlaik ir uzņemti iestādē vai tika pārvesti uz citu veselības aprūpes iestādi. Šīs grupas, ja tās ir inficētas, var pakļaut lielam skaitam cilvēku, kuriem ir lielāks risks saslimt ar smagu slimību, vai arī uzņemto pacientu situācijā viņiem pašiem ir lielāks risks saslimt ar smagu slimību.

        Informācija veselības departamentiem par gadījumu izmeklēšanu un kontaktu izsekošanu ir pieejama Veselības departamentos: Pagaidu norādījumi par Covid-19 gadījuma izmeklēšanas un kontaktpersonu izsekošanas plāna izstrādi. Šie norādījumi varētu būt noderīgi arī veselības aprūpes iestādēm, kas veic šādas darbības.

        Ikviens, kam bijis ilgstošs ciešs kontakts (6 pēdu rādiusā vismaz 15 minūtes), jāuzskata par potenciāli pakļautu. Sejas maskas lietošana avota kontrolei un citu ieteikto infekciju profilakses un kontroles (IPC) pasākumu (piemēram, roku higiēnas) ievērošana, ko veic pakalpojumu sniedzējs, palīdz samazināt pārnešanas vai smagas slimības risku. Reģionos ar mērenu vai ievērojamu pārnēsāšanu sabiedrībā pacienti jau ir pakļauti SARS-CoV-2 riskam, jo ​​tie tiek pakļauti iedarbībai ārpus savas mājas, un viņiem ir jābūt uzmanīgiem, ja attīstās pazīmes vai simptomi, kas atbilst Covid-19.

        Nosakot, kuriem pacientiem ir lielāks transmisijas risks un kuriem pacientiem var būt prioritāte novērtēšanai un pārbaudēm, jāņem vērā:

          Pacienta lietošana &ndash Atspoguļojot veselības aprūpes personālam paredzētās riska novērtēšanas vadlīnijas, pacientiem, kuri nevalkā sejas masku, varētu būt lielāks infekcijas risks nekā tiem, kuri valkā sejas masku.
      • Mijiedarbības veids, kas notikusi starp pacientu un inficēto pakalpojumu sniedzēju &ndash Mijiedarbība, kas ietver manipulācijas vai ilgstošu ciešu kontaktu ar pacientu un acīm, degunu vai muti (piemēram, zobu tīrīšana), visticamāk, rada lielāku pārnešanas risku pacientam, salīdzinot ar citām mijiedarbībām (piem., , asinsspiediena pārbaude).
      • IAL, ko izmanto inficēts HCP un ndash HCP, kas valkā sejas masku (vai respiratoru) un sejas aizsargu, kas sniedzas zem zoda, varēja labāk kontrolēt avotu, nekā valkājot tikai sejas masku. Ņemiet vērā, ka respiratori ar izelpas vārstiem var nenodrošināt avota kontroli.
      • Pašreizējais pacienta statuss &ndash Vai pacients pašlaik atrodas slimnīcā vai ilgstošas ​​​​aprūpes iestādē? Šīs personas, ja tās ir inficētas, var būt pakļautas lielākam smagas slimības riskam, un tās var pakļaut lielam skaitam indivīdu smagas slimības riskam.
      • 1. Ja HCP ir atveseļojies no SARS-CoV-2 infekcijas, bet 3 mēnešu laikā pēc sākotnējās inficēšanās ir pakļauts augsta riska iedarbībai pacientam ar SARS-CoV-2 infekciju, viņiem ir jāierobežo darbs 14 dienas pēc saskares. ?

        CDC ir publicējis pagaidu vadlīnijas riska novērtēšanai un darba ierobežojumiem HCP, kas var būt pakļauts SARS-CoV-2. Tā kā viņi bieži vien ir plaši un cieši sazinājušies ar cilvēkiem, kuriem ir augsts smagu slimību risks, šajās vadlīnijās ir ieteikta konservatīva pieeja HCP uzraudzībai un darba ierobežojumu piemērošanai, lai novērstu potenciāli lipīga HCP pārnešanu uz pacientiem, citiem HCP un apmeklētājiem. Pašlaik pieejamo pierādījumu apskats liecina, ka lielākā daļa cilvēku atkārtoti neinficējas 3 mēnešu laikā pēc SARS-CoV-2 inficēšanās. Asimptomātisku cilvēku testēšanu šajā 3 mēnešu periodā sarežģī fakts, ka dažiem cilvēkiem šajā periodā ir nosakāms vīruss no iepriekšējās inficēšanās, pozitīvs tests šajā periodā, visticamāk, izriet no iepriekšējas infekcijas, nevis no jaunas infekcijas, kas rada risku. pārraidei.

        Ņemot to vērā, pakļautie HCP, kas ir 3 mēnešu laikā pēc sākotnējās inficēšanās, varētu turpināt darbu, vienlaikus uzraugot Covid-19 atbilstošus simptomus un ievērojot visas ieteicamās infekciju profilakses un kontroles metodes (piemēram, universāla labi piemērota avota izmantošana kontrole). Ja parādās simptomi, ir jānovērtē pakļautais HCP un, iespējams, jāpārbauda SARS-CoV-2, ja nav noteikta cita etioloģija. Dažas iestādes joprojām var izvēlēties noteikt darba ierobežojumus asimptomātiska HCP gadījumā pēc augstāka riska iedarbības, īpaši, ja ir neskaidrības par iepriekšēju infekciju vai personas imūnās atbildes noturību. Piemēri var ietvert:

        • HCP ar pamata imūnsistēmas traucējumiem (piemēram, pēc orgānu transplantācijas) vai imūnsistēmas traucējumiem (piemēram, saņem ķīmijterapiju) 3 mēnešu laikā pēc SARS-Cov-2 infekcijas un kuriem varētu būt paaugstināts atkārtotas inficēšanās risks. Tomēr dati par to, kuri īpaši apstākļi var izraisīt lielāku risku, un riska lielums nav pieejami.
        • HCP, kuriem pastāv bažas, ka viņu sākotnējā SARS-CoV-2 infekcijas diagnoze varētu būt balstīta uz kļūdaini pozitīvu testa rezultātu (piemēram, indivīds bija asimptomātisks, antigēna tests bija pozitīvs un apstiprinošais nukleīnskābju amplifikācijas tests (NAAT) netika veikts). veikts).
        • HCP, par kuriem ir pierādījumi, ka viņi ir bijuši pakļauti jaunam SARS-CoV-2 variantam, kuram varētu būt lielāks atkārtotas inficēšanās risks (piemēram, saskarē ar personu, kura ir inficēta ar jaunu variantu).

        CDC turpina aktīvi izmeklēt atkārtotas inficēšanās biežumu un apstākļus, kas saistīti ar šīm epizodēm, tostarp jauno variantu lomu atkārtotā inficēšanā, un vajadzības gadījumā pielāgos norādījumus, tiklīdz būs pieejama vairāk informācijas.

        2. Ja HCP 3 mēnešu laikā pēc sākotnējās inficēšanās parādās simptomi, kas atbilst Covid-19, vai viņi ir jāizslēdz no darba un jāpārbauda atkārtoti?

        HCP 3 mēnešu laikā pēc apstiprinātas SARS-CoV-2 infekcijas, kam attīstās simptomi, kas atbilst Covid-19, ir jāizvērtē, lai noteiktu iespējamo alternatīvo simptomu etioloģiju. Ja simptomu alternatīvu etioloģiju nevar noteikt, iespējams, tie ir atkārtoti jāpārbauda attiecībā uz SARS-CoV-2 infekciju, lai saprastu, ka pozitīvs vīrusa tests varētu atspoguļot atlikušās vīrusa daļiņas no iepriekšējās infekcijas, nevis jaunu infekciju. Lēmumi par darba izslēgšanas nepieciešamību un ilgumu ir jāpieņem, pamatojoties uz viņu aizdomām par diagnozi (piemēram, gripa, SARS-CoV-2 infekcija).

        3. Vai HCP 3 mēnešu laikā pēc sākotnējās inficēšanās ir jāvalkā visi ieteicamie individuālie aizsardzības līdzekļi (IAL), aprūpējot pacientus ar aizdomām vai apstiprinātu SARS-CoV-2 infekciju? Piemēram, ja ir ierobežoti respiratori, vai respiratori būtu jāpiešķir priekšroka tiem HCP, kuri iepriekš nav bijuši inficēti?

        Neatkarīgi no aizdomīgās vai apstiprinātās imunitātes veselības aprūpes personālam, aprūpējot pacientus, vienmēr jāvalkā visi ieteicamie IAL. Situācijās, kad trūkst IAL, iekārtām vajadzētu atsaukties uz CDC stratēģijām, lai optimizētu IAL piegādi. Tomēr, tāpat kā ar citām infekcijas slimībām (piemēram, masalām), pieejamo IAL piešķiršanu nevajadzētu balstīt uz to, vai HCP ir iepriekš inficēts vai vai tam ir pierādījumi par imunitāti.

        4. Vai HCP 3 mēnešu laikā pēc sākotnējās inficēšanās ir jādod priekšroka, lai aprūpētu pacientus ar aizdomām vai apstiprinātu SARS-CoV-2 infekciju?

        Lai gan indivīdiem, kuri ir atveseļojušies no SARS-CoV-2 infekcijas, var attīstīties aizsargājoša imunitāte, šādas imunitātes ilgums un apjoms nav zināms. Lēmumiem par personālu jābūt balstītiem uz parasto telpu praksi. Jebkuram HCP, kas norīkots rūpēties par pacientiem ar aizdomām vai apstiprinātu SARS-CoV-2 infekciju, neatkarīgi no infekcijas vēstures, sniedzot aprūpi, jāievēro visi ieteiktie infekciju profilakses un kontroles pasākumi. Ir pieejami arī norādījumi par personāla trūkuma mazināšanu.

        Jā. HCP, kuriem ir jebkāda veida iedarbība, kam ieteicama mājas karantīna, ir jāizslēdz no darba:

        • Ja HCP ir var atrasties karantīnā prom no inficētās personas, kas dzīvo kopā ar viņiem, viņiem ir jāatrodas karantīnā mājās un 14 dienas pēc pēdējās saskares ar inficēto personu nedrīkst strādāt.
        • Ja HCP ir var atrasties karantīnā prom no inficētās personas, kas dzīvo kopā ar viņiem, un pastāvīgi pakļauties neaizsargātai iedarbībai visu indivīda slimības laiku, viņiem jāpaliek mājas karantīnā un jāizslēdz no darba līdz 14 dienām. pēc inficētā persona atbilst mājas izolācijas pārtraukšanas kritērijiem.
        • Ja HCP saslimst ar SARS-CoV-2 infekciju, kamēr viņi atrodas karantīnā, viņi ir jāizslēdz no darba, līdz viņi atbilst visiem SARS-CoV-2 infekcijas HCP atgriešanās darbā kritērijiem.

        Mājas karantīna un darba izslēgšana asimptomātiski pakļautiem HCP, kuri ir atveseļojušies no SARS-CoV-2 infekcijas iepriekšējos 3 mēnešos, var nebūt nepieciešami. Papildinformācija par šo scenāriju ir pieejama šeit.

        Ja personai ar iespējamu viltus pozitīvu antigēna testa rezultātu tiek veikta apstiprinoša pārbaude, IPC pasākumi ir jāsaglabā līdz rezultātam. Citu kontaktu papildu testēšanu var atlikt, līdz ir pieejami apstiprinošās pārbaudes rezultāti, ja vien netiek identificētas simptomātiskas personas.

        • Asimptomātiskajam veselības aprūpes personālam (HCP) tas ietver pastāvīgu izslēgšanu no darba, gaidot apstiprinošu pārbaudi.
        • Asimptomātiskiem pacientiem vai iedzīvotājiem tas ietver ievietošanu uz transmisiju balstītu piesardzības pasākumu ietvaros vienā istabā vai, ja vienvietīgas istabas nav pieejamas, palikšanu viņu pašreizējā telpā, gaidot apstiprinošās pārbaudes rezultātus. Viņus nedrīkst pārvietot uz Covid-19 nodaļu vai ievietot citā koplietošanas telpā ar jauniem istabas biedriem.

        Ņemot vērā antigēnu testu parasti zemāko jutību, cilvēkiem ar Covid-19 un ndash līdzīgiem simptomiem, kuriem ir negatīvs antigēna testa rezultāts, vairumā gadījumu būtu jāveic apstiprinošs nukleīnskābju amplifikācijas tests (NAAT), piemēram, reversās transkriptāzes polimerāzes ķēdes reakcija (RT-PCR). . Kamēr nav saņemti apstiprinošās pārbaudes rezultāti, saglabājiet šādus IPC pasākumus:

        • Pacienti un iedzīvotāji, kuriem ir Covid-19 un līdzīgi simptomi, ir jānovieto uz transmisiju balstītiem piesardzības pasākumiem vienā telpā (nevis Covid-19 nodaļā).
        • HCP ar Covid-19 un ndash līdzīgiem simptomiem ir jāizslēdz no darba, līdz būs pieejami apstiprinošie testa rezultāti.

        Neraugoties uz iespējamo vajadzību pēc negatīvu rezultātu apstiprinošas pārbaudes, sākotnējā antigēnu testu izmantošana simptomātiskiem cilvēkiem joprojām ir ieteicama, ja NAAT izpildes laiks ir >2 dienas, jo pozitīvs antigēna tests uzsāktu kontaktu izsekošanu un IPC pasākumu ieviešanu.

        CDC ir ieteicis vairākus veidus, kā uzlabot masku piemērotību un filtrēšanu, tostarp medicīniskās sejas maskas pārklāšanu ar auduma masku. Tomēr veselības aprūpes iestādēs maskām ir nepieciešama īpaša piesardzība.

        • Lai gan auduma masku var izmantot virs medicīniskās sejas maskas, lai uzlabotu piegulšanu, var būt labākas alternatīvas, piemēram, ierāmētas &ldquofitters&rdquo vai mezglošanas pieeja, lai panāktu labu piegulšanu. Ja laba piegulēšana tiek panākta, izmantojot vienu medicīnisko sejas masku, papildu pieejas, piemēram, slāņu pievienošana, lai panāktu labāku piegulšanu, var nebūt vajadzīgas.
        • Auduma maskas nav individuālie aizsardzības līdzekļi (IAL). Tos nedrīkst lietot medicīnisko sejas masku vai NIOSH apstiprinātu respiratoru vietā kā daļu no standarta vai uz transmisiju balstītiem piesardzības pasākumiem.
        • Medicīnas sejas maskas vai auduma maskas nēsāšana virs N95 respiratora nav ieteicama veselības aprūpes personālam veselības aprūpes iestādēs, izņemot ārkārtas vai krīzes stratēģiju ilgstošas ​​N95 respiratoru lietošanas laikā, lai aizsargātu respiratoru no piesārņojuma aerosola ģenerēšanas procedūru vai procedūru laikā, kas var radīt šļakatas. un aerosolus.
        • Nekad nav ieteicams valkāt medicīnisku sejas masku vai auduma masku zem N95 respiratora, jo tas traucēs blīvējumam.

        Veselības aprūpes iestādēs medicīniskās sejas maskas izmanto veselības aprūpes darbinieki diviem vispārīgiem mērķiem.

        • Pirmkārt, kā IAL, lai aizsargātu veselības aprūpes darbinieku un degunu un muti no pakļaušanas šļakatām, aerosoliem, šļakatām un elpceļu izdalījumiem, piemēram, ārstējot pacientus ar pilienu piesardzības pasākumiem. Lietojot kā IAL, medicīniskās sejas maskas ir jānoņem un jāizmet pēc katras tikšanās ar pacientu, ja vien ilgstoša lietošana netiek praktizēta kā daļa no krīzes vai neparedzētu iespēju stratēģijas.
          • Ja uz medicīniskās sejas maskas tiek izmantota auduma maska, tā ir jānoņem un jāizmazgā pēc katras tikšanās ar pacientu.
          • Auduma maskas nav IAL, un tās nedrīkst lietot vienas pašas, lai aizsargātu pret šļakatām un izsmidzināšanu, piemēram, ja tās lieto, ārstējot pacientus ar pilienu piesardzības pasākumiem.

          Pēc uzvilkšanas veselības aprūpes darbinieki nedrīkst pieskarties savai medicīniskajai sejas maskai vai auduma maskai. Ja viņi pieskaras savai medicīniskajai sejas maskai vai auduma maskai vai pielāgo to, viņiem pirms un pēc saskares jāveic roku higiēna.

          Ja mazgāšanu ar iepriekš aprakstītajiem intervāliem nav iespējams veikt, veselības aprūpes darbinieki veselības aprūpes iestādēs nedrīkst lietot auduma maskas.

          * Medicīniskās sejas maskas ir individuālie aizsardzības līdzekļi (IAL), un tos bieži dēvē par ķirurģiskām maskām vai procedūru maskām. Izmantojiet sejas maskas saskaņā ar produkta marķējumu un vietējām, valsts un federālajām prasībām. FDA apstiprinātas ķirurģiskās maskas ir paredzētas aizsardzībai pret šļakatām un aerosoliem, un tās ir prioritāras lietošanai, ja ir paredzama šāda iedarbība, tostarp ķirurģiskas procedūras. Sejas maskas, kuras FDA nereglamentē, piemēram, dažas procedūru maskas, kuras parasti izmanto izolācijas nolūkos, var nenodrošināt aizsardzību pret šļakatām un aerosoliem.


          Pateicības

          Mēs pateicamies Danielam Sdicu par palīdzību tumšā lauka mikroskopijā un sākotnējos eksperimentos, kā arī Dr. David M. Ojcius par dažu šajā pētījumā izmantoto baktēriju kontroles nodrošināšanu. Mēs novērtējam arī Dr. Tsui-Yin Wong palīdzību šī pētījuma laikā. Autoru darbu atbalsta Primordia Jauno zinātņu un medicīnas institūts ar dotācijām no Chang Gung Medical Research Projects (CLRPD1A0011, CLRPD1C0011-3 un QZRPD88E), Ming Chi Tehnoloģiju universitātes (0XB0), Taivānas Izglītības ministrijas (EMRPD1B047). ), un Taivānas Nacionālā zinātnes padome (101-2632-B-182-001-MY3).


          Jauns ieskats infekciozā HIV selektīvajās saistīšanās īpašībās

          Plaši tiek uzskatīts, ka brīvs infekciozais HIV-1 ir galvenā vīrusa forma inficētu personu asinīs. Tomēr ASV Militārās HIV pētniecības programmas (MHRP) pētnieki ir pierādījuši, ka būtībā visas infekciozās vīrusa daļiņas var saistīties ar sarkano asins šūnu virsmu, kas izolētas no katra no 30 normāliem (neinficētiem) donoriem.

          Rezultāti tika publicēti 15. decembrī PLoS One. Vadošie pētnieki Dr Zoltan Beck un Dr Carl Alving, pētnieki ar MHRP Retroviroloģijas nodaļā, Valtera Rīda armijas pētniecības institūtā (WRAIR), paskaidro, ka dati liecina, ka, lai gan infekciozas HIV-1 vīrusa daļiņas, kas saistās ar sarkano krāsu asins šūnas satur tikai nelielu daudzumu, iespējams, vidēji 2,3% no tipiska HIV-1 preparāta, ar eritrocītiem saistītais HIV-1 ir aptuveni 100 reizes infekciozāks nekā brīvais (ar šūnām nesaistīts) HIV. 1 mērķa šūnu inficēšanai.

          Pētījumā secināts, ka infekciozie virioni veido tikai nelielu daļu no tipiskā HIV-1 preparāta un ka laboratorijas apstākļos visi infekciozie virioni var saistīties ar sarkanajām asins šūnām un citām neatļautām šūnām (ti, šūnām, kuras nevar inficēts). Ja tas attiecas uz HIV inficētiem cilvēkiem, tas varētu nozīmēt, ka ar sarkanajām asins šūnām saistītais HIV-1 varētu būt svarīgāks par brīvo vīrusu, lai pārnestu infekciozo HIV-1 uz mērķa šūnām, kuras var inficēt.

          Dr. Alvings saka: "Ja tāda pati infekciozā HIV-1 saistīšanās ar sarkanajām asins šūnām notiek cilvēkiem, iespējams, ka ar sarkanajām asins šūnām saistītie infekcijas virioni tiek pasargāti no degradācijas vai imūnsistēmas uzbrukuma."

          Dr Beck piebilst: "Šis pētījums liecina, ka eritrocīti varētu kalpot par svarīgu un, iespējams, slēptu rezervuāru infekcioziem HIV-1 virioniem."


          Atklāšana Streptococcus mutans Genomiskā DNS cilvēka DNS paraugos, kas iegūti no siekalām un asinīm

          Kariess ir daudzfaktoru slimība, un pētījumos, kuru mērķis ir noskaidrot tās etioloģiju modulējošos faktorus, jāņem vērā visi zināmie predisponējošie faktori. Viens no galvenajiem faktoriem ir baktēriju kolonizācija un Streptococcus mutans ir galvenais mikroorganisms, kas saistīts ar slimības sākšanos. Mūsu pētījumos mums ir pieejami DNS paraugi, kas iegūti no cilvēka siekalām un asinīm. Šajā ziņojumā mēs pārbaudījām reāllaika PCR testu, kas izstrādāts, lai noteiktu genoma DNS kopijas no Streptococcus mutans 1424 cilvēku DNS paraugos.Mūsu rezultāti liecina, ka mēs varam noteikt genoma DNS kopiju klātbūtni Streptococcus mutans gan DNS paraugos no kariesa brīviem, gan ar kariesu slimiem indivīdiem. Tomēr mēs nevarējām noteikt genoma DNS kopiju klātbūtni Streptococcus mutans jebkuros DNS paraugos, kas iegūti no perifērajām asinīm, kas liecina, ka tests var nebūt pietiekami jutīgs šim mērķim. Reāllaika PCR reakcijas sliekšņa cikla vērtības korelē ar augstāku kariesa pieredzes līmeni bērniem, taču šo korelāciju nevarēja noteikt pieaugušajiem.

          1. Ievads

          Kariess joprojām ir visizplatītākā nelipīgā infekcijas slimība pasaulē [1], un ģenētiskā uzņēmība pret šo slimību ir kļuvusi par galveno uzmanību dažām pētniecības grupām, kuru mērķis ir nodrošināt jaunas stratēģijas problēmas risināšanai. Lauka pētījumus ir ārkārtīgi atvieglojusi tādu pieeju izstrāde, kas ļauj iegūt DNS no siekalu paraugiem [2]. Pēc tam šos paraugus var turēt istabas temperatūrā no vairākām dienām līdz mēnešiem, līdz var notikt ekstrakcija laboratorijā. Viens no šī darba virziena izaicinājumiem ir tas, ka ģenētisko uzņēmību pret kariesu var maskēt šīs slimības vides ietekme, piemēram, mikrobu infekcija, uztura veidi un fluorīdu iedarbība.

          Attiecībā uz mikrobu kolonizāciju, Streptococcus mutans ir galvenā suga, kas saistīta ar slimības sākšanos [apskatīts [3]]. Līdz ar to viena iespēja ir tāda, ka individuālā uzņēmība pret kolonizāciju ar Streptococcus mutans ietekmēs turpmāko kariesa pieredzi. Tomēr tradicionālā kvantitatīvā noteikšana Streptococcus mutans ar mitis-salivarius-bacitracīna agara barotni [4] ir darbietilpīga un nepieciešama tieša aplikuma paraugu kultivēšana. Uz PCR balstīta mērķauditorijas atlases metode gtf (glikoziltransferāzes) gēni Streptococcus mutans tika izstrādāts kā alternatīvs veids, kā kvantitatīvi noteikt bakteriālo infekciju cilvēkiem [5], kas ir noderīga kā praktiska diagnostikas sistēma Streptococcus mutans infekcija.

          Šim darbam bija divi galvenie mērķi. Tā kā mums ir pieejami cilvēka DNS paraugi no siekalām, teorētiski šajos paraugos ir arī subjektu perorālās mikrobu kolonizācijas genoma kopijas paraugu ņemšanas dienā. Tāpēc noteikšanai izmantojām uz PCR balstītu metodi gtf gēni Streptococcus mutans kā veidu, kā noteikt, vai subjektus kolonizēja Streptococcus mutans un pārbaudīt, kā šie dati korelē ar kariesa pieredzi. Pēc tam šī informācija varētu palīdzēt turpmākajiem ģenētikas pētījumiem un ļaut iekļaut Streptococcus mutans kolonizācija kā kovariāts analīzē. Otrais mērķis bija noteikt genoma DNS kopijas Streptococcus mutans cilvēka DNS paraugos, kas iegūti no asinīm. Kopš Streptococcus mutans var konstatēt sirds vārstuļu un ateromatozo aplikumu paraugos [6, 7], mēs izvirzām hipotēzi, ka to var noteikt arī asinsritē. Westpētīja cilvēka DNS paraugus, kas iegūti no perifērajām asinīm, lai pārbaudītu, vai nav genoma DNS kopijas Streptococcus mutans var noteikt ar PCR metodi, ko izstrādājuši Yano et al. [5].

          2. Materiāls un metodes

          2.1. Cilvēka DNS paraugi

          Visi šajā pētījumā novērtētie paraugi tika iegūti pēc Pitsburgas Universitātes, Stambulas Universitātes, CEMIC (Argentīna) un CONEP (Brazīlija) Institucionālo pārskata padomju apstiprināšanas, un no katra subjekta tika saņemta rakstiska informēta piekrišana. Šajā pētījumā kopumā tika iekļauti 1424 DNS paraugi, un tie bija pieejami no vairākām datu kopām.

          (1) No Pitsburgas Universitātes Zobārstniecības skolas Zobu reģistra un DNS repozitorija (DRDR) tika izmantoti 666 DNS paraugi, kas iegūti no veselām siekalām. Šie paraugi ir no personām no Pitsburgas un apkārtējiem reģioniem, kuru vecums ir no 4 līdz 89 gadiem (vidēji 42,9 gadi). Personas, kas ir iekļautas reģistrā, atbilst Pitsburgas pilsētas demogrāfiskajam sadalījumam (apmēram 70% balto, 20% afroamerikāņu un pārējās citas grupas). Apmēram 60% subjektu ir sievietes. Lielākā daļa personu ir no zemāka sociālekonomiskā slāņa, pamatojoties uz viņu apdrošināšanu.

          (2) No Mutes veselības atšķirību centra Apalačijā (COHRA) tika izmantoti 174 DNS paraugi, kas iegūti no pilnām asinīm un 44 no siekalām. Šie paraugi bija no piekrišanas ģimenēm, kas tika pieņemtas darbā vairākās Pensilvānijas un Rietumvirdžīnijas lauku vietās. DNS paraugi no pilnām asinīm bija no indivīdiem vecumā no 1 līdz 68 gadiem (vidēji 23,2 gadi), un DNS paraugi no siekalām bija no bērniem vecumā no 1 līdz 11 gadiem (vidēji 3,3 gadi). Šajā pētījuma grupā ietilpst virkne sociāli ekonomiskā stāvokļa (vidējie mājsaimniecības gada ienākumi ir mazāki par 25 000 USD), un tas ir diezgan reprezentatīvs Apalaču populācijai, kas daudzu mutes veselības pasākumu un mutes veselības pieejamības ziņā ieņem ļoti zemu vietu salīdzinājumā ar pārējo valsti. aprūpi. Visas šajā analīzē iekļautās personas bija baltas ar attiecību starp vīrieti un sievieti gandrīz 1,0.

          (3) No Stambulas tika izmantoti 175 DNS paraugi, kas iegūti no veselām siekalām. Šie paraugi ir no bērniem, kuru vecāki piekrita piedalīties pētījumā. Šie bērni bija vecumā no 5 līdz 6 gadiem, un 85 bija bez kariesa. Šīs personas tika pieņemtas darbā Stambulas Universitātes Pedodontijas klīnikās un Stambulas pilsētas dienas aprūpes iestādēs. Septiņdesmit deviņi bija vīrieši un 94 sievietes.

          (4) No Pitsburgas tika izmantoti arī 158 DNS paraugi, kas iegūti no veselām siekalām, kas nepārklājās ar paraugiem no Zobu reģistra un DNS repozitorija. Šie paraugi tika iegūti no personām, kurām bija piekrišana, un tās tika novērtētas kā prasība Pitsburgas Universitātes Zobārstniecības skolas studentiem, kuri apgūst karioloģijas kursu. Šo personu vecums ir no 13 līdz 82 gadiem (vidēji 43,3 gadi), un to īpašības ir ļoti līdzīgas tām, kas aprakstītas iepriekš DRDR paraugu ņemšanai.

          (5) No Gvatemalas tika izmantoti 109 DNS paraugi, kas iegūti no veselām siekalām. Šie paraugi ir no ģimenēm ar piekrišanu, kurās ir bērni, kas dzimuši ar mutes šķeltnēm un kontroles personām, kuras saņēma aprūpi medicīniskās misijas laikā, ko sponsorēja bezpeļņas organizācija Children of the Americas. Šie paraugi ir no personām, kuru vecums ir no 14 līdz 60 gadiem (vidēji 28 gadi). Četrdesmit pieci bija vīrieši un 64 sievietes. Šajā pētījumā netika iekļauti paraugi no personām, kuras dzimušas ar šķeltnēm, jo ​​pastāv ierosinājums, ka šiem indivīdiem var būt lielāks kariesa sastopamības biežums.

          (6) No Argentīnas tika izmantoti 98 DNS paraugi, kas iegūti no veselām siekalām. Šie paraugi ir no ģimenēm ar piekrišanu, kurās ir bērni, kas dzimuši ar mutes plaisām, kas dzīvo Patagonijas reģionā, no personām vecumā no 10 līdz 72 gadiem (vidēji 31,5 gadi). Paraugi no personām, kas dzimušas ar šķeltnēm, netika iekļauti, jo pastāv pieņēmums, ka šiem indivīdiem var būt lielāks kariesa sastopamības biežums. Šī pētījuma populācija būtībā ir amerikāņu mapuču un spāņu sajaukums un nāk no zemāka sociālekonomiskā slāņa. Vīriešu un sieviešu attiecība ir gandrīz 1,0.

          Visiem šajā pētījumā izmantotajiem DNS paraugiem bija pieejami DMFT/dmft (sabrukuši, trūkstoši kariesa, aizpildīti zobi) rādītāji, un tie tika iegūti, kā ieteikusi Pasaules Veselības organizācija [1]. Tie tika savākti saskaņā ar starptautiskajiem standartiem. Lielāka aktīvo kariozo bojājumu attiecība tika novērota jaunākiem subjektiem. 174 DNS paraugiem, kas iegūti no pilnām asinīm, puskvantitatīvās vērtības Streptococcus mutans bija pieejami arī (novērtēti no to pašu subjektu siekalām ar Dentocult SM Strip mutans, Orion Diagnostica Oy, P.O.Box 83, Espo, Somija). Visi 1424 DNS paraugi iepriekš tika veiksmīgi pārbaudīti citās uz PCR balstītās genotipēšanas pieejās.

          2.2. DNS ekstrakcija

          DNS tika ekstrahēta no siekalu paraugiem, izmantojot ražotāja protokolu manuālai DNS attīrīšanai no 4,0 ml, PD-PR-015, 2.0. izdevums. Siekalu paraugi iepriekš tika uzglabāti istabas temperatūrā līdz 3 mēnešiem Oragene flakonos līdz DNS ekstrakcijai. Saskaņā ar flakonu ražotāja teikto, siekalu DNS istabas temperatūrā ir stabila vairāk nekā 2 gadus [8]. Viss siekalu paraugs tika ekstrahēts ar reaģenta tilpumu, kas tika pielāgots, lai maksimāli palielinātu atgūtās DNS daudzumu. Īsumā, paraugus sajauca, apgriežot, un pēc tam inkubēja nakti 50 ° C temperatūrā. Paraugi tika pārnesti uz centrifūgas cauruli un sajaukti ar Oragene attīrītāju, inkubēti uz ledus, pēc tam centrifugēti ar ātrumu 3000 × g 20 minūtes, lai granulētu denaturēto proteīnu. Supernatants tika pārnests uz jaunu mēģeni un DNS tika izgulsnēts, pievienojot vienādu tilpumu 100% etanola. DNS granulu mazgā ar 70% etanolu, žāvēja un atkārtoti suspendēja ar TE buferšķīdumu. DNS tika inkubēta 50 ° C temperatūrā 1 stundu, kam sekoja inkubācija istabas temperatūrā nakti, lai nodrošinātu pilnīgu rehidratāciju. Lai noņemtu papildu piemaisījumus, tika veikta liela ātruma centrifugēšana ar ātrumu 15 000 × g.

          DNS tika iegūta no asins paraugiem, izmantojot QIAamp DNA Mini Kit saskaņā ar ražotāja norādījumiem.

          2.3. Reāllaika PCR tests

          Pārbaude balstījās uz eksperimentu, ko izstrādāja Yano et al. [5]. Šajā darbā DNS tika iegūta no veselām siekalām no cilvēkiem. Yano et al. [5] apstiprināja šo metodi, kā parametru izmantojot standarta kultūras pieeju. Viņi ziņoja, ka šo testu rezultāti attiecībā uz mērījumiem Streptococcus mutans ir cieši saistīti ar kultūras rezultātiem. Turklāt abu metožu jutība ir ļoti līdzīga, un reāllaika PCR spēj noteikt aptuveni 800 genoma DNS kopiju klātbūtni no Streptococcus mutans. Tomēr tests nediskriminē konkrētos Streptococcus mutans c, e vai f serotipi. Praimeri, kas izmantoti testā, pievieno konservētajiem reģioniem gtfB un gtfC gēni Streptococcus mutans, un pastiprina 415 bāzes pāru DNS fragmentus no abiem gēniem.

          Reāllaika PCR tika veikta, izmantojot ABI PRISM 7900HT Fast Real-Time PCR sistēmu (Applied Biosystems). Katrā reakcijas mēģenē bija 10 μL reakcijas maisījuma, ieskaitot 1 X SYBR Green PCR buferšķīdumu, 0,025 U/ul AmpliTaqGold DNS polimerāzes, 0,01 U/ul AmpErase UNG (uracila N-glikozilāzes), 1,2 mM katra dNTP, 3 mM MgCL2 (SYBR Green) PCR pamatreaģenti, lietišķās biosistēmas), 2 μL cilvēka DNS, kas ekstrahēts no siekalām vai asins paraugiem, un 0,8 mM katra specifiskā praimera Streptococcus mutans (uz priekšu 5′AGCCATGCGCAATCAACAGGTT3′ un atpakaļgaitā 5′CGCAACGCGAACATCTTGATCAG3′). Šo praimeru specifika tika pārbaudīta iepriekš [5] un Streptococcus mutans genoma DNS (Streptococcus mutans ATCC 25175) tika iekļauts visās reakcijās, jo tika izveidota pozitīva kontrole un standarta DNS līknes. Cikla nosacījumi uracilam bija 2 minūtes 50 ° C temperatūrā N-glikozilāze (šī apstrāde novērš pārnešanas savstarpēju inficēšanos, sagremot uracilu saturošus fragmentus, kas iegūti pirms PCR testa), 10 minūtes 95°C AmpliTaqGold aktivācijai, 40 cikli 15 sekundes 95°C denaturācijai un 1 minūti 68°C. atkausēšanai un pagarināšanai. Sliekšņa cikla (Ct) vērtības virs nulles tika uzskatītas par pozitīvām Streptococcus mutans infekcija, pamatojoties uz veiksmīgu mērķa secības pastiprināšanu. Šīs vērtības tika korelētas ar DMFT rādītājiem, un alfa 0,05 tika uzskatīta par statistiski nozīmīgu.

          3. Rezultāti

          Mūsu rezultāti bija saderīgi ar paredzamajām vērtībām, kas iegūtas no validācijas procedūrām, kuras aprakstīja Yano et al. [5]. Paraugu apakškopa tika pārbaudīta vairākas reizes dažādos laika punktos, un rezultāti tika saskaņoti. Streptococcus mutans genoma DNS tika konstatēta cilvēka siekalu paraugos gan no kariesa brīviem indivīdiem, gan indivīdiem ar iepriekšēju/pašreizēju kariesa pieredzi (1. tabula). Tomēr genoma DNS kopijas no Streptococus mutans nevarēja noteikt DNS paraugos no cilvēka perifērajām asinīm (2. tabula). Šie paraugi tika iegūti gan no pieaugušajiem, gan bērniem ar dažāda līmeņa kariesa pieredzi (3. tabula). Kad DMFT/dmft rādītāji tika korelēti ar reālā laika PCR eksperimenta sliekšņa ciklu vērtībām, statistiski nozīmīgas korelācijas tika konstatētas tikai grupās, kas sastāvēja tikai no bērnu paraugiem (2. tabula). Pieaugušo paraugu datu analīzes stratifikācija pēc vecuma būtiski nemainīja rezultātus.

          DMFT/dmft vidējaisrs statistikaT statistikaBrīvības pakāpes*Divpusēji

          4. Diskusija

          Jebkurā pētījumā, kas saistīts ar kariesa etioloģiju, jāņem vērā slimības daudzfaktoru raksturs. Mikrobu kolonizācija ir galvenais faktors, kas modulē slimības sākšanos, un tas vienmēr ir jāņem vērā. Mūsu pētījumu gadījumā, kuros mums ir DNS paraugi, kas iegūti no cilvēka siekalām, reāllaika PCR tests, ko izstrādāja Yano et al. [5], lai noteiktu genoma DNS kopiju klātbūtni Streptococcus mutans paraugā var izmantot kā norādi uz tā kolonizācijas klātbūtni.

          Mēs konstatējām klātbūtni Streptococcus mutans genoma DNS kopijas vairākos no kariesa brīviem indivīdiem (1. tabula). Šo rezultātu var interpretēt dažādos veidos. Streptococcus mutans siekalās ir nepieciešams, bet nav pietiekams, lai noteiktu slimību un/vai kariesa bojājumu klātbūtni. Mikroorganisms var atrasties indivīdiem, kuriem nav kariesa, bet to nosakāmais līmenis ir zemāks. Vēl viena iespēja ir tāda, ka līdz 10% kariesa bojājumu var izlaist, izmantojot Pasaules Veselības organizācijas ieteikto metodiku bez rentgenogrammu papildināšanas [9].

          Sleitons u.c. [10] to parādīja Streptococcus mutans līmeņi bija pozitīvi saistīti ar kariesa pieredzi bērniem vecumā no 3 līdz 5 gadiem. Autori izmērīja līmeni Streptococcus mutans ar mikrobioloģiskām pārbaudēm saskaņā ar Edelstein un Tinanoff [11] aprakstīto protokolu, pieskaroties koka mēles lāpstiņai mēles muguras virsmai, līdz tā ir mitra, un pēc tam izmantojot mēles asmeni, lai potētu selektīvās augšanas barotnes. Streptococcus mutans (CRT baktēriju komplekts, IvoclarVivadent, Schaan, Lihtenšteina). Tika ierosināta arī nozīmīga mijiedarbība starp ģenētiskajām variācijām tuftelīns, gēns, kas ierosināts iesaistīties emaljas veidošanā, un līmenis Streptococcus mutans. Iepriekš mēs nevarējām atkārtot iespējamās mijiedarbības rezultātus starp izmaiņām tuftelīns un līmeņi Streptococcus mutans [12]. Mēs izmantojām to pašu reāllaika PCR testu, kas aprakstīts šeit, lai noteiktu esamību vai neesamību Streptococcus mutans kolonizācija pētījumā. Tomēr mūsu pašreizējā analīze apstiprina Streptococcus mutans līmeņi ir saistīti ar kariesa pieredzi bērniem, apstiprinot Slayton et al. [10]. Mūsu rezultāti skaidri parāda, ka pieaugušo DMFT rādītāji nekorelē ar Streptococcus mutans kolonizācija, ko mēra ar reāllaika PCR testiem. Iespējamais iemesls ir tas Streptococcus mutans ir saistītas ar slimības sākšanos, kas parasti skar bērnus, un kariesa pieredzes punkti (dmft) galvenokārt ir saistīti ar bojātu zobu klātbūtni. Pieaugušajiem DMFT rādītājus ietekmē arī kariesa dēļ trūkstošo un aizpildīto zobu skaits, un, lai gan DMFT rādītājam ir tendence palielināt virsstundas visiem indivīdiem, Streptococcus mutans Visvairāk tiks paaugstināts gadījumos, kad veidojas jauni kariozi emaljas bojājumi. Streptococcus mutans skaits arī korelē ar cukura patēriņu, un var apgalvot, ka individuālas diētas izmaiņas maina paredzamo baktēriju skaitu, lai gan šo hipotēzi nevar viegli pārbaudīt šķērsgriezuma pētījuma plānā. Tie skaidri parāda nepieciešamību dziļi izprast kariesa etiopatoģenēzi, ierosinot pētīt ģenētisko uzņēmību pret šo slimību. Mūsu pētījums apstiprina, ka bērniem, līmenis Streptococcus mutans nepārprotami korelē ar lielāku kariesa pieredzi un lielāku uzņēmību pret slimību.

          Pieaug interese izprast mutes veselības iespējamo ietekmi uz sistēmisko veselību. Ir ierosināts, ka augstāks kariesa līmenis var būt cilvēkiem ar specifiskām sistēmiskām slimībām, piemēram, sirds un asinsvadu slimībām [13], astmu un epilepsiju [14]. Mēs nevarējām noteikt nevienu līmeni Streptococcus mutans DNS paraugos, kas iegūti no perifērajām asinīm. Tas var būt saistīts ar DNS ekstrakcijai izmantoto metodi, kas var slikti atgūties Streptococcus mutans genoma DNS paraugā vai zemā līmeņa dēļ Streptococcus mutans oriģinālajā paraugā. Ir pierādījumi, ka Streptococcus mutans var konstatēt sirds vārstuļu un ateromatozo aplikumu paraugos [6, 7] un tāpēc ceļo no mutes uz sirdi. Iespējams, ka izskaidrojums ir tāds, ka jebkurā skartās personas asins tilpumā var atrast ļoti mazu baktēriju kopiju skaitu, kas ir zemākas par reāllaika PCR testa jutību. Kamēr koncentrācija Streptococcus mutans atšķiras atkarībā no savāktā parauga rakstura (asinis vai siekalas) un no tā, kā tas ir savākts (veselas siekalas vai buferētas siekalas), šķiet, ka DNS izolācijas metodes būtiski neietekmē genoma DNS atgūšanu. Streptococcus mutans vai šī uz PCR balstītā testa veiktspēju [5]. Pastāv liela interese par pieejām, kas var palīdzēt prognozēt, kā mutes dobuma veselība var ietekmēt sistēmisko veselību, un turpmākais darbs mūsu laboratorijā būs vērsts uz mainīgo lielumu identificēšanu, kas var kalpot kā sliktas sistēmiskās veselības prognozes.

          Mūsu dati sniedz pamatojumu turpmākiem kariesa ģenētiskajiem pētījumiem jaunākām populācijām, kurās Streptococcus mutans labāk korelē ar esošajiem slimības pieredzes rādītājiem, un paraugu ņemšana mēdz būt viendabīgāka.

          Pateicības

          Nevienam no autoriem nav tiešu finansiālu saistību ar kādu šajā rakstā minēto komerciālo identitāti, kā arī nav jādeklarē kāds cits interešu konflikts. Autori ir pateicīgi visiem subjektiem, kuri ar entuziasmu piekrita piedalīties šajā projektā. Melisa Karpa pārskatīja tekstu gramatikas un stila ziņā. Datus šim pētījumam sniedza Pitsburgas Universitātes Zobārstniecības skolas zobārstniecības reģistrs un DNS krātuve. Viņi pateicas Children of the Americas, Inc. par atbalstu datu vākšanas laikā Gvatemalā. N. F. Kalahans un es.Anjomshoaa atbalstīja programma CTSI START UP, īstermiņa pirmsdoktorantūras balva, ko sniedz Klīniskās un translācijas zinātnes institūts un Pitsburgas Universitātes Klīniskās pētniecības izglītības institūts (NIH Grant 5TL1RR024155-02). Finansiālu atbalstu šim darbam sniedza NIH Grants R01-DE018914 (AR Vieira), R01-DE014899 (ML Marazita, AR Vieira, RJ Weyant, R. Crout, DW McNeil), R01-DE016148 (ML Marazita, AR Vieira). , EE Castilla), P50-DE016215 (uz ML Marazita) no Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT), Argentīna, Granta Nr.: PICTO-CRUP 2005 Nr. 31101, ko iesniedza Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Argentīna, lai saņemtu ECLAMC finansiālu atbalstu no CNPq (Brazīlijas Nacionālās pētniecības padomes), process Nr. 573993/2008-4 INAGEMP. Finansētājiem nebija nekādas nozīmes pētījuma izstrādē, datu vākšanā un analīzē, lēmuma par publicēšanu vai darba sagatavošanā.

          Atsauces

          1. Pasaules Veselības organizācija, “Pasaules mutes veselības ziņojums 2003”, Tech. Rep., Pasaules Veselības organizācija, Ženēva, Šveice, 2003. Skatīt: Google Scholar
          2. T. Rylander-Rudqvist, N. Hakansson, G. Tybring un A. Wolk, “Siekalu DNS kvalitāte un daudzums, kas iegūts ar pašpārvaldes oragene metodi — izmēģinājuma pētījums par zviedru vīriešu kohortu” Vēža epidemioloģijas biomarķieri un profilakse, sēj. 15, Nr. 9, 1742.–1745. lpp., 2006. Skatīt: izdevēja vietne | Google Scholar
          3. J. M. Tanzer, J. Livingston un A. M. Thompson, “Primārā zobu kariesa mikrobioloģija cilvēkiem”, Zobārstniecības izglītības žurnāls, sēj. 65, Nr. 10, 1028.–1037. lpp., 2001. Skatīt: Google Scholar
          4. O. G. Golds, H. V. Džordans un J. Van Hūts, “Selektīvs līdzeklis Streptococcus mutans,” Mutes bioloģijas arhīvs, sēj. 18, Nr. 11, 1357.–1364. lpp., 1973. Skatīt: Google Scholar
          5. A. Yano, N. Kaneko, H. Ida, T. Yamaguchi un N. Hanada, “Reāllaika PCR kvantitatīvai noteikšanai Streptococcus mutans,” FEMS mikrobioloģijas vēstules, sēj. 217, Nr. 1, 23.–30. lpp., 2002. Skatīt: izdevēja vietne | Google Scholar
          6. K. Nakano, H. Inaba, R. Nomura et al., “Detection of cariogenic Streptococcus mutans ekstirpēto sirds vārstuļu un ateromatozās plāksnes paraugos. Klīniskās mikrobioloģijas žurnāls, sēj. 44, Nr. 9, 3313.–3317. lpp., 2006. Skatīt: izdevēja vietne | Google Scholar
          7. K. Nakano, H. Nemoto, R. Nomura et al., “Mutes baktēriju noteikšana sirds un asinsvadu paraugos” Mutes mikrobioloģija un imunoloģija, sēj. 24, Nr. 1, 64.–68. lpp., 2009. Skatīt: izdevēja vietne | Google Scholar
          8. R. M. Ivasiovs, A. Desbuā un H. K. Birnboims, Ilgtermiņa DNS stabilitāte no siekalu paraugiem, kas glabāti Oragene®DNS, DNA Genotek, Ontario, Kanāda, 2004.
          9. S. F. Mestriner, L. C. Pardini un W. Mestriner, “Kodināšanas rentgenogrāfijas eksāmena iekļaušanas ietekme uz zobu kariesa izplatību 12 gadus veciem skolēniem Frankas pilsētā Sanpaulu, Brazīlijā” Lietišķās mutvārdu zinātnes žurnāls, sēj. 14, Nr. 3, 167.–171. lpp., 2006. Skatīt: Google Scholar
          10. R. L. Sleitons, M. E. Kūpers un M. L. Marazita, “Tuftelīns, mutans streptokoki un zobu kariesa jutība” Zobārstniecības pētījumu žurnāls, sēj. 84, Nr. 8, 711.–714. lpp., 2005. Skatīt: izdevēja vietne | Google Scholar
          11. B. Edelstein un N. Tinanoff, “Pirmsskolas vecuma bērnu skrīnings zobu kariesa noteikšanai, izmantojot mikrobu testu” Bērnu zobārstniecība, sēj. 11, Nr. 2, 129.–132. lpp., 1989. Skatīt: Google Scholar
          12. K. Deeley, A. Letra, E. K. Rose u.c., “Iespējama amelogenīna saistība ar augstu kariesa pieredzi Gvatemalas-maiju populācijā” Kariesa izpēte, sēj. 42, Nr. 1, 8.–13. lpp., 2008. Skatīt: izdevēja vietne | Google Scholar
          13. P. Holm-Pedersen, K. Avlund, D. E. Morse et al., "Zobu kariess, periodonta slimības un sirds aritmijas sabiedrībā dzīvojošiem gados vecākiem cilvēkiem vecumā no 80 gadiem: vai pastāv saikne?" Amerikas Geriatrijas biedrības žurnāls, sēj. 53, Nr. 3, 430.–437. lpp., 2005. Skatīt: izdevēja vietne | Google Scholar
          14. I. Anjomshoaa, M. E. Cooper un A. R. Vieira, “Kariess ir saistīts ar astmu un epilepsiju”, Eiropas zobārstniecības žurnāls, sēj. 3, 297.–303. lpp., 2009. Skatīt: Google Scholar

          Autortiesības

          Autortiesības © 2011 Alexandre R. Vieira et al. Šis ir atvērtas piekļuves raksts, kas tiek izplatīts saskaņā ar Creative Commons Attribution License, kas atļauj neierobežotu izmantošanu, izplatīšanu un reproducēšanu jebkurā datu nesējā, ja oriģinālais darbs ir pareizi citēts.


          Skatīties video: Bacterial Infections in Humans (Decembris 2022).